Incidental Mutation 'R5543:Slc37a3'
ID436093
Institutional Source Beutler Lab
Gene Symbol Slc37a3
Ensembl Gene ENSMUSG00000029924
Gene Namesolute carrier family 37 (glycerol-3-phosphate transporter), member 3
Synonyms
MMRRC Submission 043101-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5543 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location39334773-39377675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 39355026 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 158 (G158C)
Ref Sequence ENSEMBL: ENSMUSP00000087709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090243] [ENSMUST00000200771] [ENSMUST00000200961] [ENSMUST00000200969] [ENSMUST00000201448] [ENSMUST00000202204] [ENSMUST00000202400] [ENSMUST00000202749]
Predicted Effect probably damaging
Transcript: ENSMUST00000090243
AA Change: G158C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087709
Gene: ENSMUSG00000029924
AA Change: G158C

DomainStartEndE-ValueType
Pfam:MFS_1 23 420 3.8e-37 PFAM
Pfam:Sugar_tr 27 262 2.5e-8 PFAM
transmembrane domain 423 445 N/A INTRINSIC
transmembrane domain 455 477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200771
SMART Domains Protein: ENSMUSP00000143953
Gene: ENSMUSG00000029924

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200961
SMART Domains Protein: ENSMUSP00000144562
Gene: ENSMUSG00000029924

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200969
SMART Domains Protein: ENSMUSP00000144244
Gene: ENSMUSG00000029924

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201448
SMART Domains Protein: ENSMUSP00000144059
Gene: ENSMUSG00000029924

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202204
SMART Domains Protein: ENSMUSP00000144316
Gene: ENSMUSG00000029924

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202400
AA Change: G158C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144557
Gene: ENSMUSG00000029924
AA Change: G158C

DomainStartEndE-ValueType
Pfam:MFS_1 12 173 2.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202749
SMART Domains Protein: ENSMUSP00000144636
Gene: ENSMUSG00000029924

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik C A 7: 128,237,181 S80I probably benign Het
Aak1 T C 6: 86,982,645 probably null Het
Abcc6 A G 7: 45,989,536 probably null Het
Acvr1 A G 2: 58,463,145 S268P probably damaging Het
Apod T C 16: 31,303,533 probably null Het
Atp5o T C 16: 91,926,530 I58V probably benign Het
AU040320 C T 4: 126,841,224 T777M probably damaging Het
BC067074 C A 13: 113,320,873 T1151K probably damaging Het
Ccne2 A T 4: 11,194,026 N89I probably benign Het
Dnah7a A G 1: 53,504,069 V2314A probably damaging Het
Dopey2 T C 16: 93,798,920 S1881P probably damaging Het
E4f1 A G 17: 24,447,362 V24A possibly damaging Het
Esrrg A T 1: 188,150,254 D236V probably damaging Het
Fam240b T A 13: 64,485,922 I27F possibly damaging Het
Fat1 T A 8: 45,023,479 I1854N probably damaging Het
Fchsd2 T C 7: 101,271,699 Y480H probably damaging Het
Fras1 A G 5: 96,528,535 N47S probably benign Het
Gabrr3 T C 16: 59,433,507 S196P probably damaging Het
Gbp8 T A 5: 105,017,830 D319V possibly damaging Het
Hrh3 G T 2: 180,103,970 A61E probably damaging Het
Idua T C 5: 108,670,229 I89T probably benign Het
Ifitm3 T A 7: 141,009,817 I108F unknown Het
Izumo4 T C 10: 80,702,834 F40S probably damaging Het
Kifc2 A G 15: 76,667,042 R679G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ldha A T 7: 46,850,890 I171F possibly damaging Het
Lrfn4 T C 19: 4,612,163 S609G probably benign Het
Mmp15 T C 8: 95,368,101 F201S possibly damaging Het
Myof C T 19: 37,981,330 V295I probably benign Het
Olfr1024 G T 2: 85,904,328 A242D probably damaging Het
Olfr30 T A 11: 58,455,167 M261L probably damaging Het
Olfr354 C T 2: 36,907,357 T137I possibly damaging Het
Parp14 T C 16: 35,834,767 D1778G probably benign Het
Pcnt A T 10: 76,412,052 D969E probably benign Het
Pibf1 A T 14: 99,112,992 N192I probably benign Het
Pitpnm3 A G 11: 72,056,197 F792S probably damaging Het
Pkd2 T A 5: 104,489,333 I604N probably damaging Het
Pla2g15 T C 8: 106,161,143 Y188H probably damaging Het
Plxnc1 G T 10: 94,864,774 D643E probably benign Het
Prrc2c G A 1: 162,673,511 P1241L probably damaging Het
Ptprd T C 4: 76,059,753 E173G probably damaging Het
Shank3 T C 15: 89,532,354 V232A probably damaging Het
Shbg A G 11: 69,616,738 I171T probably damaging Het
Slc22a14 A T 9: 119,173,608 F404L probably benign Het
Slfn9 C A 11: 82,982,381 L565F probably damaging Het
Tex43 G A 18: 56,594,688 probably benign Het
Trank1 T A 9: 111,366,112 M1068K probably damaging Het
Trbv15 A T 6: 41,141,253 I15L probably benign Het
Ttn C T 2: 76,739,574 V26992M probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b34 T A 5: 86,906,701 I74F probably damaging Het
Vamp3 A G 4: 151,051,020 L47P probably damaging Het
Zfp143 T A 7: 110,083,315 C363* probably null Het
Zfp438 T C 18: 5,213,761 E399G probably damaging Het
Other mutations in Slc37a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Slc37a3 APN 6 39337262 missense probably damaging 1.00
IGL02447:Slc37a3 APN 6 39337195 missense probably benign 0.00
IGL03017:Slc37a3 APN 6 39349381 missense probably benign 0.13
IGL03142:Slc37a3 APN 6 39359985 splice site probably null
IGL03164:Slc37a3 APN 6 39345303 missense probably benign 0.02
R0240:Slc37a3 UTSW 6 39337238 missense probably benign 0.02
R0551:Slc37a3 UTSW 6 39352754 unclassified probably benign
R1453:Slc37a3 UTSW 6 39366943 missense probably damaging 1.00
R1866:Slc37a3 UTSW 6 39359968 missense probably damaging 1.00
R2242:Slc37a3 UTSW 6 39338805 missense probably benign 0.00
R4410:Slc37a3 UTSW 6 39338813 missense probably benign
R4784:Slc37a3 UTSW 6 39337223 missense probably benign 0.12
R4983:Slc37a3 UTSW 6 39352717 nonsense probably null
R6309:Slc37a3 UTSW 6 39357460 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACAGCCTTAAGAACGTGCCTC -3'
(R):5'- TATCCTGGAAAGCAGTTGGG -3'

Sequencing Primer
(F):5'- GAACGTGCCTCTCTGGATATTTACAG -3'
(R):5'- AAGCAGTTGGGTGTATTGAAACGTC -3'
Posted On2016-10-24