Incidental Mutation 'R5543:Klk14'
ID436096
Institutional Source Beutler Lab
Gene Symbol Klk14
Ensembl Gene ENSMUSG00000044737
Gene Namekallikrein related-peptidase 14
Synonyms
MMRRC Submission 043101-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5543 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43690418-43695536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43692077 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 51 (C51Y)
Ref Sequence ENSEMBL: ENSMUSP00000056935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056329]
Predicted Effect probably damaging
Transcript: ENSMUST00000056329
AA Change: C51Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056935
Gene: ENSMUSG00000044737
AA Change: C51Y

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 23 243 2.02e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205416
Meta Mutation Damage Score 0.7935 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that have diverse physiological functions such as regulation of blood pressure and desquamation. The encoded protein is a precursor that undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. The encoded enzyme was found to activate the complement pathway by cleavage of C3 to release C3a anaphylotoxin. This gene is one of the several glandular kallikrein genes located in a cluster on chromosome 7. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik C A 7: 128,237,181 S80I probably benign Het
Aak1 T C 6: 86,982,645 probably null Het
Abcc6 A G 7: 45,989,536 probably null Het
Acvr1 A G 2: 58,463,145 S268P probably damaging Het
Apod T C 16: 31,303,533 probably null Het
Atp5o T C 16: 91,926,530 I58V probably benign Het
AU040320 C T 4: 126,841,224 T777M probably damaging Het
BC067074 C A 13: 113,320,873 T1151K probably damaging Het
Ccne2 A T 4: 11,194,026 N89I probably benign Het
Dnah7a A G 1: 53,504,069 V2314A probably damaging Het
Dopey2 T C 16: 93,798,920 S1881P probably damaging Het
E4f1 A G 17: 24,447,362 V24A possibly damaging Het
Esrrg A T 1: 188,150,254 D236V probably damaging Het
Fam240b T A 13: 64,485,922 I27F possibly damaging Het
Fat1 T A 8: 45,023,479 I1854N probably damaging Het
Fchsd2 T C 7: 101,271,699 Y480H probably damaging Het
Fras1 A G 5: 96,528,535 N47S probably benign Het
Gabrr3 T C 16: 59,433,507 S196P probably damaging Het
Gbp8 T A 5: 105,017,830 D319V possibly damaging Het
Hrh3 G T 2: 180,103,970 A61E probably damaging Het
Idua T C 5: 108,670,229 I89T probably benign Het
Ifitm3 T A 7: 141,009,817 I108F unknown Het
Izumo4 T C 10: 80,702,834 F40S probably damaging Het
Kifc2 A G 15: 76,667,042 R679G probably damaging Het
Ldha A T 7: 46,850,890 I171F possibly damaging Het
Lrfn4 T C 19: 4,612,163 S609G probably benign Het
Mmp15 T C 8: 95,368,101 F201S possibly damaging Het
Myof C T 19: 37,981,330 V295I probably benign Het
Olfr1024 G T 2: 85,904,328 A242D probably damaging Het
Olfr30 T A 11: 58,455,167 M261L probably damaging Het
Olfr354 C T 2: 36,907,357 T137I possibly damaging Het
Parp14 T C 16: 35,834,767 D1778G probably benign Het
Pcnt A T 10: 76,412,052 D969E probably benign Het
Pibf1 A T 14: 99,112,992 N192I probably benign Het
Pitpnm3 A G 11: 72,056,197 F792S probably damaging Het
Pkd2 T A 5: 104,489,333 I604N probably damaging Het
Pla2g15 T C 8: 106,161,143 Y188H probably damaging Het
Plxnc1 G T 10: 94,864,774 D643E probably benign Het
Prrc2c G A 1: 162,673,511 P1241L probably damaging Het
Ptprd T C 4: 76,059,753 E173G probably damaging Het
Shank3 T C 15: 89,532,354 V232A probably damaging Het
Shbg A G 11: 69,616,738 I171T probably damaging Het
Slc22a14 A T 9: 119,173,608 F404L probably benign Het
Slc37a3 C A 6: 39,355,026 G158C probably damaging Het
Slfn9 C A 11: 82,982,381 L565F probably damaging Het
Tex43 G A 18: 56,594,688 probably benign Het
Trank1 T A 9: 111,366,112 M1068K probably damaging Het
Trbv15 A T 6: 41,141,253 I15L probably benign Het
Ttn C T 2: 76,739,574 V26992M probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b34 T A 5: 86,906,701 I74F probably damaging Het
Vamp3 A G 4: 151,051,020 L47P probably damaging Het
Zfp143 T A 7: 110,083,315 C363* probably null Het
Zfp438 T C 18: 5,213,761 E399G probably damaging Het
Other mutations in Klk14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0309:Klk14 UTSW 7 43694345 missense probably benign 0.01
R0467:Klk14 UTSW 7 43694110 missense probably benign 0.33
R1432:Klk14 UTSW 7 43694918 missense probably damaging 1.00
R1575:Klk14 UTSW 7 43693953 critical splice acceptor site probably null
R2160:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2185:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2188:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2189:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2472:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2474:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2961:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2962:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2968:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3147:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3148:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3176:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3177:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3276:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3277:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3418:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3419:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3430:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3956:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4080:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4081:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4152:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4153:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4169:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4205:Klk14 UTSW 7 43694934 missense probably benign 0.00
R4284:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4285:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4287:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4356:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4359:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4379:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4380:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4381:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4611:Klk14 UTSW 7 43694357 missense probably damaging 1.00
R4684:Klk14 UTSW 7 43691968 missense probably benign
R4784:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4792:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4793:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4825:Klk14 UTSW 7 43692076 missense probably damaging 1.00
R4844:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4847:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4884:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4898:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4941:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4942:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4943:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4972:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4997:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5021:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5022:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5024:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5053:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5054:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5056:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5057:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5097:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5253:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5257:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5459:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5489:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5490:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5493:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R6823:Klk14 UTSW 7 43694456 nonsense probably null
X0064:Klk14 UTSW 7 43694110 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AAGATCTCTGTCTGCTGGGC -3'
(R):5'- TGGCAAGGGTTCTACATACAC -3'

Sequencing Primer
(F):5'- ATCTCTGTCTGCTGGGCATTGG -3'
(R):5'- TGAATTATGCCTCTCAGCCTAG -3'
Posted On2016-10-24