Incidental Mutation 'R5543:Ldha'
ID436098
Institutional Source Beutler Lab
Gene Symbol Ldha
Ensembl Gene ENSMUSG00000063229
Gene Namelactate dehydrogenase A
Synonymsl7R2, Ldh-1, LDH-A, lactate dehydrogenase-A, Ldh1
MMRRC Submission 043101-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5543 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location46841475-46855627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46850890 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 171 (I171F)
Ref Sequence ENSEMBL: ENSMUSP00000148107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005051] [ENSMUST00000048209] [ENSMUST00000092621] [ENSMUST00000125862] [ENSMUST00000132157] [ENSMUST00000133062] [ENSMUST00000147535] [ENSMUST00000209548] [ENSMUST00000209984] [ENSMUST00000210467] [ENSMUST00000210631] [ENSMUST00000210815] [ENSMUST00000210968]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005051
AA Change: I142F

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103267
Gene: ENSMUSG00000063229
AA Change: I142F

DomainStartEndE-ValueType
Pfam:Ldh_1_N 50 189 2.5e-52 PFAM
Pfam:Ldh_1_C 192 360 2.7e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000048209
AA Change: I142F

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036386
Gene: ENSMUSG00000063229
AA Change: I142F

DomainStartEndE-ValueType
Pfam:Ldh_1_N 21 160 3e-53 PFAM
Pfam:Ldh_1_C 163 331 1.2e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092621
AA Change: I142F

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097661
Gene: ENSMUSG00000063229
AA Change: I142F

DomainStartEndE-ValueType
Pfam:Ldh_1_N 21 160 3.9e-54 PFAM
Pfam:Ldh_1_C 163 237 3.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124696
Predicted Effect probably benign
Transcript: ENSMUST00000125862
Predicted Effect probably benign
Transcript: ENSMUST00000132157
AA Change: I142F

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000133062
Predicted Effect possibly damaging
Transcript: ENSMUST00000147535
AA Change: I142F

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123356
Gene: ENSMUSG00000063229
AA Change: I142F

DomainStartEndE-ValueType
Pfam:Ldh_1_N 58 197 5.7e-54 PFAM
Pfam:Ldh_1_C 200 273 5.7e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209548
AA Change: I142F

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209984
AA Change: I171F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210198
Predicted Effect probably benign
Transcript: ENSMUST00000210467
Predicted Effect unknown
Transcript: ENSMUST00000210631
AA Change: Y133F
Predicted Effect possibly damaging
Transcript: ENSMUST00000210815
AA Change: I125F

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000210968
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene catalyzes the conversion of L-lactate and NAD to pyruvate and NADH in the final step of anaerobic glycolysis. The protein is found predominantly in muscle tissue and belongs to the lactate dehydrogenase family. Mutations in this gene have been linked to hemolytic anemia and early postimplantation death in mice. Multiple transcript variants encoding different isoforms have been found for this gene. The mouse genome contains multiple pseudogenes of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for one chemically induced mutation exhibit severe hemolytic anemia with pronounced reticulocytosis and hyperbilirubinemia. Another mutation results in prenatal lethality in homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik C A 7: 128,237,181 S80I probably benign Het
Aak1 T C 6: 86,982,645 probably null Het
Abcc6 A G 7: 45,989,536 probably null Het
Acvr1 A G 2: 58,463,145 S268P probably damaging Het
Apod T C 16: 31,303,533 probably null Het
Atp5o T C 16: 91,926,530 I58V probably benign Het
AU040320 C T 4: 126,841,224 T777M probably damaging Het
BC067074 C A 13: 113,320,873 T1151K probably damaging Het
Ccne2 A T 4: 11,194,026 N89I probably benign Het
Dnah7a A G 1: 53,504,069 V2314A probably damaging Het
Dopey2 T C 16: 93,798,920 S1881P probably damaging Het
E4f1 A G 17: 24,447,362 V24A possibly damaging Het
Esrrg A T 1: 188,150,254 D236V probably damaging Het
Fam240b T A 13: 64,485,922 I27F possibly damaging Het
Fat1 T A 8: 45,023,479 I1854N probably damaging Het
Fchsd2 T C 7: 101,271,699 Y480H probably damaging Het
Fras1 A G 5: 96,528,535 N47S probably benign Het
Gabrr3 T C 16: 59,433,507 S196P probably damaging Het
Gbp8 T A 5: 105,017,830 D319V possibly damaging Het
Hrh3 G T 2: 180,103,970 A61E probably damaging Het
Idua T C 5: 108,670,229 I89T probably benign Het
Ifitm3 T A 7: 141,009,817 I108F unknown Het
Izumo4 T C 10: 80,702,834 F40S probably damaging Het
Kifc2 A G 15: 76,667,042 R679G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrfn4 T C 19: 4,612,163 S609G probably benign Het
Mmp15 T C 8: 95,368,101 F201S possibly damaging Het
Myof C T 19: 37,981,330 V295I probably benign Het
Olfr1024 G T 2: 85,904,328 A242D probably damaging Het
Olfr30 T A 11: 58,455,167 M261L probably damaging Het
Olfr354 C T 2: 36,907,357 T137I possibly damaging Het
Parp14 T C 16: 35,834,767 D1778G probably benign Het
Pcnt A T 10: 76,412,052 D969E probably benign Het
Pibf1 A T 14: 99,112,992 N192I probably benign Het
Pitpnm3 A G 11: 72,056,197 F792S probably damaging Het
Pkd2 T A 5: 104,489,333 I604N probably damaging Het
Pla2g15 T C 8: 106,161,143 Y188H probably damaging Het
Plxnc1 G T 10: 94,864,774 D643E probably benign Het
Prrc2c G A 1: 162,673,511 P1241L probably damaging Het
Ptprd T C 4: 76,059,753 E173G probably damaging Het
Shank3 T C 15: 89,532,354 V232A probably damaging Het
Shbg A G 11: 69,616,738 I171T probably damaging Het
Slc22a14 A T 9: 119,173,608 F404L probably benign Het
Slc37a3 C A 6: 39,355,026 G158C probably damaging Het
Slfn9 C A 11: 82,982,381 L565F probably damaging Het
Tex43 G A 18: 56,594,688 probably benign Het
Trank1 T A 9: 111,366,112 M1068K probably damaging Het
Trbv15 A T 6: 41,141,253 I15L probably benign Het
Ttn C T 2: 76,739,574 V26992M probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b34 T A 5: 86,906,701 I74F probably damaging Het
Vamp3 A G 4: 151,051,020 L47P probably damaging Het
Zfp143 T A 7: 110,083,315 C363* probably null Het
Zfp438 T C 18: 5,213,761 E399G probably damaging Het
Other mutations in Ldha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Ldha APN 7 46850178 missense possibly damaging 0.79
IGL01993:Ldha APN 7 46855100 missense possibly damaging 0.73
IGL02814:Ldha APN 7 46850891 nonsense probably null
R0530:Ldha UTSW 7 46853993 missense probably damaging 0.99
R1302:Ldha UTSW 7 46847639 missense probably damaging 1.00
R4948:Ldha UTSW 7 46847381 missense probably benign 0.00
R5327:Ldha UTSW 7 46854098 missense probably benign
R5413:Ldha UTSW 7 46850896 missense possibly damaging 0.54
R5763:Ldha UTSW 7 46847789 intron probably benign
R7232:Ldha UTSW 7 46850899 missense probably benign 0.31
R7660:Ldha UTSW 7 46850257 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTCTGAATGTAGTTGCAAAGTTTAGG -3'
(R):5'- AAGACTTACCACTGGAGTCGC -3'

Sequencing Primer
(F):5'- TTTGATCCCAGCACTCAGGAG -3'
(R):5'- GAGTCGCCATGTTCTCCCAG -3'
Posted On2016-10-24