Incidental Mutation 'R5543:Pla2g15'
ID436106
Institutional Source Beutler Lab
Gene Symbol Pla2g15
Ensembl Gene ENSMUSG00000031903
Gene Namephospholipase A2, group XV
SynonymsLpla2, LLPL, Lypla3, C87498
MMRRC Submission 043101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R5543 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location106150399-106164715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106161143 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 188 (Y188H)
Ref Sequence ENSEMBL: ENSMUSP00000034377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034377] [ENSMUST00000212963]
Predicted Effect probably damaging
Transcript: ENSMUST00000034377
AA Change: Y188H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034377
Gene: ENSMUSG00000031903
AA Change: Y188H

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:LCAT 72 399 6.2e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212116
Predicted Effect probably benign
Transcript: ENSMUST00000212963
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lysophospholipases are enzymes that act on biological membranes to regulate the multifunctional lysophospholipids. The protein encoded by this gene hydrolyzes lysophosphatidylcholine to glycerophosphorylcholine and a free fatty acid. This enzyme is present in the plasma and thought to be associated with high-density lipoprotein. A later paper contradicts the function of this gene. It demonstrates that this gene encodes a lysosomal enzyme instead of a lysophospholipase and has both calcium-independent phospholipase A2 and transacylase activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice do not develop atherosclerotic lesions even when fed an atherogenic diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik C A 7: 128,237,181 S80I probably benign Het
Aak1 T C 6: 86,982,645 probably null Het
Abcc6 A G 7: 45,989,536 probably null Het
Acvr1 A G 2: 58,463,145 S268P probably damaging Het
Apod T C 16: 31,303,533 probably null Het
Atp5o T C 16: 91,926,530 I58V probably benign Het
AU040320 C T 4: 126,841,224 T777M probably damaging Het
BC067074 C A 13: 113,320,873 T1151K probably damaging Het
Ccne2 A T 4: 11,194,026 N89I probably benign Het
Dnah7a A G 1: 53,504,069 V2314A probably damaging Het
Dopey2 T C 16: 93,798,920 S1881P probably damaging Het
E4f1 A G 17: 24,447,362 V24A possibly damaging Het
Esrrg A T 1: 188,150,254 D236V probably damaging Het
Fam240b T A 13: 64,485,922 I27F possibly damaging Het
Fat1 T A 8: 45,023,479 I1854N probably damaging Het
Fchsd2 T C 7: 101,271,699 Y480H probably damaging Het
Fras1 A G 5: 96,528,535 N47S probably benign Het
Gabrr3 T C 16: 59,433,507 S196P probably damaging Het
Gbp8 T A 5: 105,017,830 D319V possibly damaging Het
Hrh3 G T 2: 180,103,970 A61E probably damaging Het
Idua T C 5: 108,670,229 I89T probably benign Het
Ifitm3 T A 7: 141,009,817 I108F unknown Het
Izumo4 T C 10: 80,702,834 F40S probably damaging Het
Kifc2 A G 15: 76,667,042 R679G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ldha A T 7: 46,850,890 I171F possibly damaging Het
Lrfn4 T C 19: 4,612,163 S609G probably benign Het
Mmp15 T C 8: 95,368,101 F201S possibly damaging Het
Myof C T 19: 37,981,330 V295I probably benign Het
Olfr1024 G T 2: 85,904,328 A242D probably damaging Het
Olfr30 T A 11: 58,455,167 M261L probably damaging Het
Olfr354 C T 2: 36,907,357 T137I possibly damaging Het
Parp14 T C 16: 35,834,767 D1778G probably benign Het
Pcnt A T 10: 76,412,052 D969E probably benign Het
Pibf1 A T 14: 99,112,992 N192I probably benign Het
Pitpnm3 A G 11: 72,056,197 F792S probably damaging Het
Pkd2 T A 5: 104,489,333 I604N probably damaging Het
Plxnc1 G T 10: 94,864,774 D643E probably benign Het
Prrc2c G A 1: 162,673,511 P1241L probably damaging Het
Ptprd T C 4: 76,059,753 E173G probably damaging Het
Shank3 T C 15: 89,532,354 V232A probably damaging Het
Shbg A G 11: 69,616,738 I171T probably damaging Het
Slc22a14 A T 9: 119,173,608 F404L probably benign Het
Slc37a3 C A 6: 39,355,026 G158C probably damaging Het
Slfn9 C A 11: 82,982,381 L565F probably damaging Het
Tex43 G A 18: 56,594,688 probably benign Het
Trank1 T A 9: 111,366,112 M1068K probably damaging Het
Trbv15 A T 6: 41,141,253 I15L probably benign Het
Ttn C T 2: 76,739,574 V26992M probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b34 T A 5: 86,906,701 I74F probably damaging Het
Vamp3 A G 4: 151,051,020 L47P probably damaging Het
Zfp143 T A 7: 110,083,315 C363* probably null Het
Zfp438 T C 18: 5,213,761 E399G probably damaging Het
Other mutations in Pla2g15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pla2g15 APN 8 106163116 missense probably benign 0.00
IGL02719:Pla2g15 APN 8 106160196 missense probably benign 0.01
IGL03065:Pla2g15 APN 8 106160219 missense probably benign 0.20
R0125:Pla2g15 UTSW 8 106163124 missense probably benign 0.00
R1691:Pla2g15 UTSW 8 106154949 missense possibly damaging 0.93
R1939:Pla2g15 UTSW 8 106163295 missense probably damaging 0.96
R3887:Pla2g15 UTSW 8 106161135 missense probably damaging 0.99
R4633:Pla2g15 UTSW 8 106160255 missense probably damaging 1.00
R4702:Pla2g15 UTSW 8 106163059 missense probably benign 0.08
R4703:Pla2g15 UTSW 8 106163059 missense probably benign 0.08
R4705:Pla2g15 UTSW 8 106163059 missense probably benign 0.08
R4766:Pla2g15 UTSW 8 106163071 missense probably damaging 1.00
R4928:Pla2g15 UTSW 8 106163218 nonsense probably null
R6489:Pla2g15 UTSW 8 106163194 missense probably benign 0.10
R6802:Pla2g15 UTSW 8 106150581 missense probably damaging 0.99
R7381:Pla2g15 UTSW 8 106162944 missense probably benign 0.03
R7961:Pla2g15 UTSW 8 106160284 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACCTTTGGGGAAACTAGTCTGC -3'
(R):5'- TGCCGGCAGAATAACGAGAC -3'

Sequencing Primer
(F):5'- GGGAAACTAGTCTGCTCCTACTTAG -3'
(R):5'- TGGCAACTGGCATGCAC -3'
Posted On2016-10-24