Incidental Mutation 'R5543:Plxnc1'
ID436111
Institutional Source Beutler Lab
Gene Symbol Plxnc1
Ensembl Gene ENSMUSG00000074785
Gene Nameplexin C1
SynonymsCD232, vespr, 2510048K12Rik
MMRRC Submission 043101-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.645) question?
Stock #R5543 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location94790866-94944835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 94864774 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 643 (D643E)
Ref Sequence ENSEMBL: ENSMUSP00000096939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099337]
Predicted Effect probably benign
Transcript: ENSMUST00000099337
AA Change: D643E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785
AA Change: D643E

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Sema 87 431 5.5e-10 PFAM
PSI 454 507 5.28e-12 SMART
PSI 590 634 1.07e-3 SMART
Pfam:TIG 665 752 3.7e-9 PFAM
IPT 755 847 5.14e-7 SMART
IPT 849 954 1.8e-2 SMART
low complexity region 978 997 N/A INTRINSIC
Pfam:Plexin_cytopl 1018 1541 1.4e-199 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181244
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik C A 7: 128,237,181 S80I probably benign Het
Aak1 T C 6: 86,982,645 probably null Het
Abcc6 A G 7: 45,989,536 probably null Het
Acvr1 A G 2: 58,463,145 S268P probably damaging Het
Apod T C 16: 31,303,533 probably null Het
Atp5o T C 16: 91,926,530 I58V probably benign Het
AU040320 C T 4: 126,841,224 T777M probably damaging Het
BC067074 C A 13: 113,320,873 T1151K probably damaging Het
Ccne2 A T 4: 11,194,026 N89I probably benign Het
Dnah7a A G 1: 53,504,069 V2314A probably damaging Het
Dopey2 T C 16: 93,798,920 S1881P probably damaging Het
E4f1 A G 17: 24,447,362 V24A possibly damaging Het
Esrrg A T 1: 188,150,254 D236V probably damaging Het
Fam240b T A 13: 64,485,922 I27F possibly damaging Het
Fat1 T A 8: 45,023,479 I1854N probably damaging Het
Fchsd2 T C 7: 101,271,699 Y480H probably damaging Het
Fras1 A G 5: 96,528,535 N47S probably benign Het
Gabrr3 T C 16: 59,433,507 S196P probably damaging Het
Gbp8 T A 5: 105,017,830 D319V possibly damaging Het
Hrh3 G T 2: 180,103,970 A61E probably damaging Het
Idua T C 5: 108,670,229 I89T probably benign Het
Ifitm3 T A 7: 141,009,817 I108F unknown Het
Izumo4 T C 10: 80,702,834 F40S probably damaging Het
Kifc2 A G 15: 76,667,042 R679G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ldha A T 7: 46,850,890 I171F possibly damaging Het
Lrfn4 T C 19: 4,612,163 S609G probably benign Het
Mmp15 T C 8: 95,368,101 F201S possibly damaging Het
Myof C T 19: 37,981,330 V295I probably benign Het
Olfr1024 G T 2: 85,904,328 A242D probably damaging Het
Olfr30 T A 11: 58,455,167 M261L probably damaging Het
Olfr354 C T 2: 36,907,357 T137I possibly damaging Het
Parp14 T C 16: 35,834,767 D1778G probably benign Het
Pcnt A T 10: 76,412,052 D969E probably benign Het
Pibf1 A T 14: 99,112,992 N192I probably benign Het
Pitpnm3 A G 11: 72,056,197 F792S probably damaging Het
Pkd2 T A 5: 104,489,333 I604N probably damaging Het
Pla2g15 T C 8: 106,161,143 Y188H probably damaging Het
Prrc2c G A 1: 162,673,511 P1241L probably damaging Het
Ptprd T C 4: 76,059,753 E173G probably damaging Het
Shank3 T C 15: 89,532,354 V232A probably damaging Het
Shbg A G 11: 69,616,738 I171T probably damaging Het
Slc22a14 A T 9: 119,173,608 F404L probably benign Het
Slc37a3 C A 6: 39,355,026 G158C probably damaging Het
Slfn9 C A 11: 82,982,381 L565F probably damaging Het
Tex43 G A 18: 56,594,688 probably benign Het
Trank1 T A 9: 111,366,112 M1068K probably damaging Het
Trbv15 A T 6: 41,141,253 I15L probably benign Het
Ttn C T 2: 76,739,574 V26992M probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b34 T A 5: 86,906,701 I74F probably damaging Het
Vamp3 A G 4: 151,051,020 L47P probably damaging Het
Zfp143 T A 7: 110,083,315 C363* probably null Het
Zfp438 T C 18: 5,213,761 E399G probably damaging Het
Other mutations in Plxnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Plxnc1 APN 10 94847549 missense probably benign 0.25
IGL01285:Plxnc1 APN 10 94799368 missense probably damaging 0.99
IGL01867:Plxnc1 APN 10 94798146 missense possibly damaging 0.61
IGL01994:Plxnc1 APN 10 94849939 missense probably damaging 1.00
IGL02083:Plxnc1 APN 10 94922725 missense possibly damaging 0.61
IGL02250:Plxnc1 APN 10 94871031 missense probably benign 0.00
IGL02429:Plxnc1 APN 10 94882591 missense probably benign 0.00
IGL02752:Plxnc1 APN 10 94794680 unclassified probably null
IGL02973:Plxnc1 APN 10 94810684 missense probably damaging 1.00
R0230:Plxnc1 UTSW 10 94799347 missense probably benign 0.07
R0265:Plxnc1 UTSW 10 94813129 missense probably benign 0.14
R0271:Plxnc1 UTSW 10 94837918 missense probably null 1.00
R0299:Plxnc1 UTSW 10 94849821 critical splice donor site probably null
R0361:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
R0441:Plxnc1 UTSW 10 94796482 missense probably damaging 1.00
R0558:Plxnc1 UTSW 10 94837935 missense probably damaging 1.00
R0617:Plxnc1 UTSW 10 94799368 missense probably damaging 1.00
R0671:Plxnc1 UTSW 10 94799332 missense possibly damaging 0.63
R0692:Plxnc1 UTSW 10 94837500 critical splice donor site probably null
R0751:Plxnc1 UTSW 10 94831333 splice site probably benign
R1184:Plxnc1 UTSW 10 94831333 splice site probably benign
R1260:Plxnc1 UTSW 10 94831365 missense probably damaging 0.99
R1680:Plxnc1 UTSW 10 94841551 missense probably benign 0.14
R1746:Plxnc1 UTSW 10 94844179 splice site probably null
R1750:Plxnc1 UTSW 10 94799497 missense probably damaging 1.00
R1751:Plxnc1 UTSW 10 94849815 unclassified probably benign
R1768:Plxnc1 UTSW 10 94844322 missense probably benign 0.05
R1876:Plxnc1 UTSW 10 94866941 missense possibly damaging 0.94
R2004:Plxnc1 UTSW 10 94852622 missense probably damaging 0.98
R2031:Plxnc1 UTSW 10 94943667 missense probably benign 0.26
R2184:Plxnc1 UTSW 10 94944269 missense probably damaging 1.00
R2437:Plxnc1 UTSW 10 94906533 missense probably benign 0.02
R2927:Plxnc1 UTSW 10 94793292 critical splice acceptor site probably null
R3001:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3002:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3003:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3441:Plxnc1 UTSW 10 94871010 missense probably benign 0.00
R3849:Plxnc1 UTSW 10 94794432 missense probably benign 0.01
R3884:Plxnc1 UTSW 10 94910687 intron probably null
R4004:Plxnc1 UTSW 10 94794597 nonsense probably null
R4679:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
R4730:Plxnc1 UTSW 10 94867468 intron probably benign
R4937:Plxnc1 UTSW 10 94841473 missense probably damaging 1.00
R5068:Plxnc1 UTSW 10 94799377 missense possibly damaging 0.91
R5345:Plxnc1 UTSW 10 94849969 missense probably benign 0.26
R5397:Plxnc1 UTSW 10 94843752 missense probably benign 0.08
R5416:Plxnc1 UTSW 10 94837554 missense probably damaging 1.00
R5485:Plxnc1 UTSW 10 94922742 missense probably benign 0.00
R5826:Plxnc1 UTSW 10 94799473 critical splice donor site probably null
R6007:Plxnc1 UTSW 10 94793290 missense possibly damaging 0.88
R6018:Plxnc1 UTSW 10 94943848 missense probably benign 0.21
R6052:Plxnc1 UTSW 10 94943773 missense probably benign 0.13
R6291:Plxnc1 UTSW 10 94833642 splice site probably null
R6653:Plxnc1 UTSW 10 94943876 missense probably damaging 1.00
R6984:Plxnc1 UTSW 10 94831530 missense probably damaging 1.00
R7086:Plxnc1 UTSW 10 94831435 missense probably benign
R7401:Plxnc1 UTSW 10 94871005 missense probably benign
R7727:Plxnc1 UTSW 10 94944109 missense probably damaging 1.00
R7789:Plxnc1 UTSW 10 94794477 missense probably damaging 1.00
R7803:Plxnc1 UTSW 10 94943515 critical splice donor site probably null
R7809:Plxnc1 UTSW 10 94794440 missense probably damaging 1.00
R7882:Plxnc1 UTSW 10 94843836 missense probably benign
R7965:Plxnc1 UTSW 10 94843836 missense probably benign
RF003:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
RF045:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF046:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF047:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
X0024:Plxnc1 UTSW 10 94864715 critical splice donor site probably null
Z1176:Plxnc1 UTSW 10 94865029 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GAAAGCCTTTGATGTATTGAGCC -3'
(R):5'- TGCGAACCATCAGACTATGAGAG -3'

Sequencing Primer
(F):5'- TGAGCCAATTATGTGAAACTTGG -3'
(R):5'- CGAACCATCAGACTATGAGAGGAATC -3'
Posted On2016-10-24