Incidental Mutation 'R5543:Pitpnm3'
ID436114
Institutional Source Beutler Lab
Gene Symbol Pitpnm3
Ensembl Gene ENSMUSG00000040543
Gene NamePITPNM family member 3
SynonymsAckr6, A330068P14Rik
MMRRC Submission 043101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5543 (G1)
Quality Score125
Status Not validated
Chromosome11
Chromosomal Location72047528-72135778 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72056197 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 792 (F792S)
Ref Sequence ENSEMBL: ENSMUSP00000104148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075258] [ENSMUST00000108508]
Predicted Effect probably damaging
Transcript: ENSMUST00000075258
AA Change: F808S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074737
Gene: ENSMUSG00000040543
AA Change: F808S

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 37 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Blast:DDHD 141 361 1e-105 BLAST
DDHD 390 594 1.49e-91 SMART
LNS2 739 870 2.12e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108508
AA Change: F792S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104148
Gene: ENSMUSG00000040543
AA Change: F792S

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 37 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
Blast:DDHD 125 345 1e-106 BLAST
DDHD 374 578 1.49e-91 SMART
LNS2 723 854 2.12e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134210
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of membrane-associated phosphatidylinositol transfer domain-containing proteins. The calcium-binding protein has phosphatidylinositol (PI) transfer activity and interacts with the protein tyrosine kinase PTK2B (also known as PYK2). The protein is homologous to a Drosophila protein that is implicated in the visual transduction pathway in flies. Mutations in this gene result in autosomal dominant cone dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik C A 7: 128,237,181 S80I probably benign Het
Aak1 T C 6: 86,982,645 probably null Het
Abcc6 A G 7: 45,989,536 probably null Het
Acvr1 A G 2: 58,463,145 S268P probably damaging Het
Apod T C 16: 31,303,533 probably null Het
Atp5o T C 16: 91,926,530 I58V probably benign Het
AU040320 C T 4: 126,841,224 T777M probably damaging Het
BC067074 C A 13: 113,320,873 T1151K probably damaging Het
Ccne2 A T 4: 11,194,026 N89I probably benign Het
Dnah7a A G 1: 53,504,069 V2314A probably damaging Het
Dopey2 T C 16: 93,798,920 S1881P probably damaging Het
E4f1 A G 17: 24,447,362 V24A possibly damaging Het
Esrrg A T 1: 188,150,254 D236V probably damaging Het
Fam240b T A 13: 64,485,922 I27F possibly damaging Het
Fat1 T A 8: 45,023,479 I1854N probably damaging Het
Fchsd2 T C 7: 101,271,699 Y480H probably damaging Het
Fras1 A G 5: 96,528,535 N47S probably benign Het
Gabrr3 T C 16: 59,433,507 S196P probably damaging Het
Gbp8 T A 5: 105,017,830 D319V possibly damaging Het
Hrh3 G T 2: 180,103,970 A61E probably damaging Het
Idua T C 5: 108,670,229 I89T probably benign Het
Ifitm3 T A 7: 141,009,817 I108F unknown Het
Izumo4 T C 10: 80,702,834 F40S probably damaging Het
Kifc2 A G 15: 76,667,042 R679G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ldha A T 7: 46,850,890 I171F possibly damaging Het
Lrfn4 T C 19: 4,612,163 S609G probably benign Het
Mmp15 T C 8: 95,368,101 F201S possibly damaging Het
Myof C T 19: 37,981,330 V295I probably benign Het
Olfr1024 G T 2: 85,904,328 A242D probably damaging Het
Olfr30 T A 11: 58,455,167 M261L probably damaging Het
Olfr354 C T 2: 36,907,357 T137I possibly damaging Het
Parp14 T C 16: 35,834,767 D1778G probably benign Het
Pcnt A T 10: 76,412,052 D969E probably benign Het
Pibf1 A T 14: 99,112,992 N192I probably benign Het
Pkd2 T A 5: 104,489,333 I604N probably damaging Het
Pla2g15 T C 8: 106,161,143 Y188H probably damaging Het
Plxnc1 G T 10: 94,864,774 D643E probably benign Het
Prrc2c G A 1: 162,673,511 P1241L probably damaging Het
Ptprd T C 4: 76,059,753 E173G probably damaging Het
Shank3 T C 15: 89,532,354 V232A probably damaging Het
Shbg A G 11: 69,616,738 I171T probably damaging Het
Slc22a14 A T 9: 119,173,608 F404L probably benign Het
Slc37a3 C A 6: 39,355,026 G158C probably damaging Het
Slfn9 C A 11: 82,982,381 L565F probably damaging Het
Tex43 G A 18: 56,594,688 probably benign Het
Trank1 T A 9: 111,366,112 M1068K probably damaging Het
Trbv15 A T 6: 41,141,253 I15L probably benign Het
Ttn C T 2: 76,739,574 V26992M probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b34 T A 5: 86,906,701 I74F probably damaging Het
Vamp3 A G 4: 151,051,020 L47P probably damaging Het
Zfp143 T A 7: 110,083,315 C363* probably null Het
Zfp438 T C 18: 5,213,761 E399G probably damaging Het
Other mutations in Pitpnm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:Pitpnm3 APN 11 72112251 splice site probably benign
IGL01871:Pitpnm3 APN 11 72056138 missense probably damaging 0.99
IGL02058:Pitpnm3 APN 11 72120139 missense probably benign 0.31
IGL02267:Pitpnm3 APN 11 72071448 missense probably benign 0.02
IGL02370:Pitpnm3 APN 11 72051858 missense probably benign 0.04
IGL02613:Pitpnm3 APN 11 72058072 missense probably damaging 1.00
IGL02835:Pitpnm3 APN 11 72061466 splice site probably benign
IGL02946:Pitpnm3 APN 11 72092552 missense probably benign 0.08
IGL02989:Pitpnm3 APN 11 72120186 splice site probably benign
IGL03173:Pitpnm3 APN 11 72092563 missense probably benign 0.02
IGL03357:Pitpnm3 APN 11 72070890 nonsense probably null
Frank UTSW 11 72070396 missense probably benign
Mickey UTSW 11 72070964 missense probably damaging 1.00
Stuart UTSW 11 72051929 missense probably null 0.99
R0102:Pitpnm3 UTSW 11 72056246 missense probably damaging 1.00
R0193:Pitpnm3 UTSW 11 72070492 splice site probably benign
R0964:Pitpnm3 UTSW 11 72058470 missense probably damaging 1.00
R1475:Pitpnm3 UTSW 11 72074627 missense probably damaging 1.00
R1566:Pitpnm3 UTSW 11 72058959 splice site probably null
R1951:Pitpnm3 UTSW 11 72074624 missense possibly damaging 0.88
R3915:Pitpnm3 UTSW 11 72112284 missense probably damaging 1.00
R4192:Pitpnm3 UTSW 11 72051959 missense possibly damaging 0.96
R4278:Pitpnm3 UTSW 11 72074516 missense probably damaging 1.00
R4928:Pitpnm3 UTSW 11 72063172 missense probably damaging 1.00
R5626:Pitpnm3 UTSW 11 72112332 missense probably benign 0.04
R5635:Pitpnm3 UTSW 11 72067160 missense possibly damaging 0.95
R5958:Pitpnm3 UTSW 11 72112367 splice site probably null
R6531:Pitpnm3 UTSW 11 72071487 missense possibly damaging 0.94
R6634:Pitpnm3 UTSW 11 72051929 missense probably null 0.99
R6764:Pitpnm3 UTSW 11 72051233 missense probably damaging 1.00
R6912:Pitpnm3 UTSW 11 72070396 missense probably benign
R7132:Pitpnm3 UTSW 11 72051276 missense possibly damaging 0.86
R7307:Pitpnm3 UTSW 11 72070964 missense probably damaging 1.00
R7561:Pitpnm3 UTSW 11 72051182 missense probably benign 0.02
R7771:Pitpnm3 UTSW 11 72061488 nonsense probably null
X0018:Pitpnm3 UTSW 11 72071440 missense probably benign 0.42
X0062:Pitpnm3 UTSW 11 72067108 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTCCCTTGACATTGAGAG -3'
(R):5'- ATTACTGCTGGCTTCTCCGG -3'

Sequencing Primer
(F):5'- TCCCTTGACATTGAGAGAGAAG -3'
(R):5'- CAGCTGTCAGGGCAGAAACTTG -3'
Posted On2016-10-24