Incidental Mutation 'R5544:Retreg2'
ID436135
Institutional Source Beutler Lab
Gene Symbol Retreg2
Ensembl Gene ENSMUSG00000049339
Gene Namereticulophagy regulator family member 2
SynonymsMGC47289, Fam134a
MMRRC Submission 043102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5544 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75142778-75147913 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to G at 75144689 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glycine at position 174 (*174G)
Ref Sequence ENSEMBL: ENSMUSP00000139508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041213] [ENSMUST00000097694] [ENSMUST00000168720] [ENSMUST00000187901] [ENSMUST00000188873] [ENSMUST00000189403] [ENSMUST00000189650] [ENSMUST00000189809] [ENSMUST00000190240] [ENSMUST00000190679]
Predicted Effect probably benign
Transcript: ENSMUST00000041213
SMART Domains Protein: ENSMUSP00000044799
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Pfam:Cyclin 72 174 7.5e-10 PFAM
low complexity region 231 252 N/A INTRINSIC
low complexity region 256 268 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097694
AA Change: M203R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095300
Gene: ENSMUSG00000049339
AA Change: M203R

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 84 114 N/A INTRINSIC
transmembrane domain 198 220 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 453 491 N/A INTRINSIC
low complexity region 506 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168720
SMART Domains Protein: ENSMUSP00000132688
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Pfam:Cyclin 49 174 5.2e-13 PFAM
Pfam:Cyclin_N 55 175 4.4e-6 PFAM
low complexity region 231 252 N/A INTRINSIC
low complexity region 256 268 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000186037
AA Change: M151R
Predicted Effect probably benign
Transcript: ENSMUST00000187901
SMART Domains Protein: ENSMUSP00000140636
Gene: ENSMUSG00000049339

DomainStartEndE-ValueType
low complexity region 12 39 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000188873
AA Change: *174G
SMART Domains Protein: ENSMUSP00000139508
Gene: ENSMUSG00000049339
AA Change: *174G

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 84 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188977
Predicted Effect probably benign
Transcript: ENSMUST00000189345
Predicted Effect probably benign
Transcript: ENSMUST00000189403
SMART Domains Protein: ENSMUSP00000141062
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Pfam:Cyclin 44 170 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189650
SMART Domains Protein: ENSMUSP00000139473
Gene: ENSMUSG00000049339

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 45 75 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189809
SMART Domains Protein: ENSMUSP00000140262
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Blast:CYCLIN 81 114 1e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000190240
AA Change: M203R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139410
Gene: ENSMUSG00000049339
AA Change: M203R

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:Reticulon 65 231 1.4e-8 PFAM
low complexity region 269 283 N/A INTRINSIC
low complexity region 435 454 N/A INTRINSIC
low complexity region 469 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190679
SMART Domains Protein: ENSMUSP00000140289
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Pfam:Cyclin 49 174 5.2e-13 PFAM
Pfam:Cyclin_N 55 175 4.4e-6 PFAM
low complexity region 231 252 N/A INTRINSIC
low complexity region 256 268 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 G A 9: 30,952,703 A372T probably damaging Het
Ap4m1 A G 5: 138,178,370 T411A probably benign Het
Arid3b T A 9: 57,798,097 K274* probably null Het
Bcan A G 3: 87,993,053 probably null Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
C9 T A 15: 6,497,027 V514D probably damaging Het
Cdk2 A C 10: 128,699,139 D336E probably benign Het
Corin A T 5: 72,305,014 Y825* probably null Het
Cyp17a1 A G 19: 46,672,654 Y64H probably damaging Het
Dock4 T G 12: 40,834,702 I1735S possibly damaging Het
Dock7 T C 4: 98,967,257 H1486R probably damaging Het
Fam171b C A 2: 83,855,527 A185D possibly damaging Het
Fbxl13 A G 5: 21,524,491 I441T probably damaging Het
Gm7347 T A 5: 26,055,018 D178V possibly damaging Het
Greb1 C A 12: 16,673,796 C1884F probably damaging Het
Kdr G A 5: 75,960,743 R536* probably null Het
Lamc2 T C 1: 153,124,053 T1187A possibly damaging Het
Mal T A 2: 127,635,017 H142L probably damaging Het
Map4k2 A C 19: 6,345,914 probably null Het
Morn4 T C 19: 42,076,247 T101A possibly damaging Het
Neto2 A G 8: 85,647,877 V241A possibly damaging Het
Nprl2 T C 9: 107,544,609 V232A probably benign Het
Pcdhb13 T C 18: 37,443,520 V317A possibly damaging Het
Pcdhb17 T A 18: 37,487,421 C755S possibly damaging Het
Pgc A G 17: 47,732,504 D259G probably benign Het
Ptprh C A 7: 4,580,910 E228* probably null Het
R3hdml A G 2: 163,498,422 T170A probably damaging Het
Rps6ka1 A G 4: 133,872,015 S34P probably benign Het
Rptn A G 3: 93,398,473 T1038A possibly damaging Het
Sel1l3 A T 5: 53,200,302 V116D probably damaging Het
Sidt2 A T 9: 45,944,455 Y509N probably damaging Het
Slc16a11 T A 11: 70,215,000 probably null Het
Thsd7a G T 6: 12,379,471 Q985K possibly damaging Het
Ttn T C 2: 76,726,538 N30041S probably benign Het
Vmn1r231 A G 17: 20,890,578 I25T probably damaging Het
Wdr81 T C 11: 75,441,797 D1926G probably damaging Het
Other mutations in Retreg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Retreg2 APN 1 75145105 critical splice donor site probably null
IGL01625:Retreg2 APN 1 75144715 unclassified probably benign
R0143:Retreg2 UTSW 1 75146430 missense possibly damaging 0.82
R1248:Retreg2 UTSW 1 75145111 unclassified probably benign
R1446:Retreg2 UTSW 1 75143459 missense possibly damaging 0.69
R1463:Retreg2 UTSW 1 75146520 missense probably damaging 0.98
R1734:Retreg2 UTSW 1 75142986 unclassified probably null
R1851:Retreg2 UTSW 1 75146675 missense probably benign 0.00
R1852:Retreg2 UTSW 1 75146675 missense probably benign 0.00
R2883:Retreg2 UTSW 1 75146712 missense probably benign 0.01
R3027:Retreg2 UTSW 1 75146444 missense probably damaging 0.99
R4665:Retreg2 UTSW 1 75144666 missense probably damaging 1.00
R5497:Retreg2 UTSW 1 75144989 missense probably damaging 1.00
R6143:Retreg2 UTSW 1 75146886 missense probably damaging 1.00
R6881:Retreg2 UTSW 1 75146439 missense probably damaging 1.00
R7576:Retreg2 UTSW 1 75144688 missense probably damaging 0.99
R7822:Retreg2 UTSW 1 75146541 missense possibly damaging 0.63
Z1176:Retreg2 UTSW 1 75145743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAATGGTTGCAGGAGTCG -3'
(R):5'- TTTCTCAAGGCAGTGATACCC -3'

Sequencing Primer
(F):5'- GCAGTGACTGTTGTAAATTTCCTC -3'
(R):5'- AAGGCAGTGATACCCTCTTCC -3'
Posted On2016-10-24