Incidental Mutation 'R5544:Mal'
ID436138
Institutional Source Beutler Lab
Gene Symbol Mal
Ensembl Gene ENSMUSG00000027375
Gene Namemyelin and lymphocyte protein, T cell differentiation protein
SynonymsVIP17
MMRRC Submission 043102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R5544 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location127633226-127656695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127635017 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 142 (H142L)
Ref Sequence ENSEMBL: ENSMUSP00000028854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028853] [ENSMUST00000028854]
Predicted Effect probably damaging
Transcript: ENSMUST00000028853
AA Change: H86L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028853
Gene: ENSMUSG00000027375
AA Change: H86L

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000028854
AA Change: H142L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028854
Gene: ENSMUSG00000027375
AA Change: H142L

DomainStartEndE-ValueType
Pfam:MARVEL 18 145 6.6e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a highly hydrophobic integral membrane protein belonging to the MAL family of proteolipids. The encoded protein has been localized to the endoplasmic reticulum of T-cells and is a candidate linker protein in T-cell signal transduction. In addition, this proteolipid is localized in compact myelin of cells in the nervous system and has been implicated in myelin biogenesis and/or function. The protein plays a role in the formation, stabilization and maintenance of glycosphingolipid-enriched membrane microdomains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous null mice display abnormal myelination and optic nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 G A 9: 30,952,703 A372T probably damaging Het
Ap4m1 A G 5: 138,178,370 T411A probably benign Het
Arid3b T A 9: 57,798,097 K274* probably null Het
Bcan A G 3: 87,993,053 probably null Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
C9 T A 15: 6,497,027 V514D probably damaging Het
Cdk2 A C 10: 128,699,139 D336E probably benign Het
Corin A T 5: 72,305,014 Y825* probably null Het
Cyp17a1 A G 19: 46,672,654 Y64H probably damaging Het
Dock4 T G 12: 40,834,702 I1735S possibly damaging Het
Dock7 T C 4: 98,967,257 H1486R probably damaging Het
Fam171b C A 2: 83,855,527 A185D possibly damaging Het
Fbxl13 A G 5: 21,524,491 I441T probably damaging Het
Gm7347 T A 5: 26,055,018 D178V possibly damaging Het
Greb1 C A 12: 16,673,796 C1884F probably damaging Het
Kdr G A 5: 75,960,743 R536* probably null Het
Lamc2 T C 1: 153,124,053 T1187A possibly damaging Het
Map4k2 A C 19: 6,345,914 probably null Het
Morn4 T C 19: 42,076,247 T101A possibly damaging Het
Neto2 A G 8: 85,647,877 V241A possibly damaging Het
Nprl2 T C 9: 107,544,609 V232A probably benign Het
Pcdhb13 T C 18: 37,443,520 V317A possibly damaging Het
Pcdhb17 T A 18: 37,487,421 C755S possibly damaging Het
Pgc A G 17: 47,732,504 D259G probably benign Het
Ptprh C A 7: 4,580,910 E228* probably null Het
R3hdml A G 2: 163,498,422 T170A probably damaging Het
Retreg2 T G 1: 75,144,689 *174G probably null Het
Rps6ka1 A G 4: 133,872,015 S34P probably benign Het
Rptn A G 3: 93,398,473 T1038A possibly damaging Het
Sel1l3 A T 5: 53,200,302 V116D probably damaging Het
Sidt2 A T 9: 45,944,455 Y509N probably damaging Het
Slc16a11 T A 11: 70,215,000 probably null Het
Thsd7a G T 6: 12,379,471 Q985K possibly damaging Het
Ttn T C 2: 76,726,538 N30041S probably benign Het
Vmn1r231 A G 17: 20,890,578 I25T probably damaging Het
Wdr81 T C 11: 75,441,797 D1926G probably damaging Het
Other mutations in Mal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Mal APN 2 127640314 missense probably damaging 1.00
R0017:Mal UTSW 2 127640307 missense probably damaging 1.00
R0352:Mal UTSW 2 127640366 missense probably damaging 1.00
R1675:Mal UTSW 2 127635044 missense probably benign 0.39
R5085:Mal UTSW 2 127640273 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CGCGAATATGGCTTGAATATGGC -3'
(R):5'- AAGCCTGGTTACCTCACCTG -3'

Sequencing Primer
(F):5'- ATGGCTTGAATATGGCTTCCTTTTG -3'
(R):5'- TGGACATCCTTCAAAGGCTG -3'
Posted On2016-10-24