Incidental Mutation 'R5544:Bcan'
ID436140
Institutional Source Beutler Lab
Gene Symbol Bcan
Ensembl Gene ENSMUSG00000004892
Gene Namebrevican
SynonymsCspg7
MMRRC Submission 043102-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5544 (G1)
Quality Score164
Status Not validated
Chromosome3
Chromosomal Location87987531-88000230 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 87993053 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000088491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090971] [ENSMUST00000194193]
Predicted Effect probably null
Transcript: ENSMUST00000090971
SMART Domains Protein: ENSMUSP00000088491
Gene: ENSMUSG00000004892

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGv 51 138 5.74e-13 SMART
LINK 154 251 9.37e-55 SMART
LINK 255 353 2.67e-59 SMART
low complexity region 355 369 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
EGF 625 658 1.07e-5 SMART
CLECT 664 785 1.15e-33 SMART
CCP 791 847 2.7e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193276
Predicted Effect probably benign
Transcript: ENSMUST00000194193
SMART Domains Protein: ENSMUSP00000141455
Gene: ENSMUSG00000004892

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:IGv 51 105 1e-33 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194596
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lectican family of chondroitin sulfate proteoglycans that is specifically expressed in the central nervous system. This protein is developmentally regulated and may function in the formation of the brain extracellular matrix. This protein is highly expressed in gliomas and may promote the growth and cell motility of brain tumor cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutation of this gene results in impaired LTP maintenance, but mutant animals show normal behavior and spatial learning capabilities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 G A 9: 30,952,703 A372T probably damaging Het
Ap4m1 A G 5: 138,178,370 T411A probably benign Het
Arid3b T A 9: 57,798,097 K274* probably null Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
C9 T A 15: 6,497,027 V514D probably damaging Het
Cdk2 A C 10: 128,699,139 D336E probably benign Het
Corin A T 5: 72,305,014 Y825* probably null Het
Cyp17a1 A G 19: 46,672,654 Y64H probably damaging Het
Dock4 T G 12: 40,834,702 I1735S possibly damaging Het
Dock7 T C 4: 98,967,257 H1486R probably damaging Het
Fam171b C A 2: 83,855,527 A185D possibly damaging Het
Fbxl13 A G 5: 21,524,491 I441T probably damaging Het
Gm7347 T A 5: 26,055,018 D178V possibly damaging Het
Greb1 C A 12: 16,673,796 C1884F probably damaging Het
Kdr G A 5: 75,960,743 R536* probably null Het
Lamc2 T C 1: 153,124,053 T1187A possibly damaging Het
Mal T A 2: 127,635,017 H142L probably damaging Het
Map4k2 A C 19: 6,345,914 probably null Het
Morn4 T C 19: 42,076,247 T101A possibly damaging Het
Neto2 A G 8: 85,647,877 V241A possibly damaging Het
Nprl2 T C 9: 107,544,609 V232A probably benign Het
Pcdhb13 T C 18: 37,443,520 V317A possibly damaging Het
Pcdhb17 T A 18: 37,487,421 C755S possibly damaging Het
Pgc A G 17: 47,732,504 D259G probably benign Het
Ptprh C A 7: 4,580,910 E228* probably null Het
R3hdml A G 2: 163,498,422 T170A probably damaging Het
Retreg2 T G 1: 75,144,689 *174G probably null Het
Rps6ka1 A G 4: 133,872,015 S34P probably benign Het
Rptn A G 3: 93,398,473 T1038A possibly damaging Het
Sel1l3 A T 5: 53,200,302 V116D probably damaging Het
Sidt2 A T 9: 45,944,455 Y509N probably damaging Het
Slc16a11 T A 11: 70,215,000 probably null Het
Thsd7a G T 6: 12,379,471 Q985K possibly damaging Het
Ttn T C 2: 76,726,538 N30041S probably benign Het
Vmn1r231 A G 17: 20,890,578 I25T probably damaging Het
Wdr81 T C 11: 75,441,797 D1926G probably damaging Het
Other mutations in Bcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Bcan APN 3 87994174 missense probably damaging 1.00
IGL00981:Bcan APN 3 87997832 missense possibly damaging 0.66
IGL02355:Bcan APN 3 87994142 missense possibly damaging 0.65
IGL02362:Bcan APN 3 87994142 missense possibly damaging 0.65
IGL03190:Bcan APN 3 87993050 unclassified probably benign
R0392:Bcan UTSW 3 87993562 nonsense probably null
R0938:Bcan UTSW 3 87993154 missense possibly damaging 0.96
R1118:Bcan UTSW 3 87989227 missense probably damaging 1.00
R1559:Bcan UTSW 3 87994212 missense probably damaging 0.96
R1653:Bcan UTSW 3 87994196 missense probably damaging 0.99
R1699:Bcan UTSW 3 87989236 missense probably damaging 1.00
R1762:Bcan UTSW 3 87993625 missense probably benign 0.00
R1802:Bcan UTSW 3 87993108 missense possibly damaging 0.58
R1870:Bcan UTSW 3 87995601 missense probably damaging 1.00
R1929:Bcan UTSW 3 87993094 missense probably damaging 1.00
R2172:Bcan UTSW 3 87996581 missense probably damaging 1.00
R2271:Bcan UTSW 3 87993094 missense probably damaging 1.00
R4036:Bcan UTSW 3 87996116 critical splice donor site probably null
R4363:Bcan UTSW 3 87997098 missense probably damaging 1.00
R4491:Bcan UTSW 3 87990233 nonsense probably null
R5111:Bcan UTSW 3 87994207 missense probably damaging 1.00
R5122:Bcan UTSW 3 87994207 missense probably damaging 1.00
R5167:Bcan UTSW 3 87994207 missense probably damaging 1.00
R5234:Bcan UTSW 3 87996146 missense probably damaging 1.00
R5363:Bcan UTSW 3 87995487 missense probably damaging 1.00
R5365:Bcan UTSW 3 87989235 missense probably damaging 1.00
R5663:Bcan UTSW 3 87995613 missense probably damaging 0.98
R6044:Bcan UTSW 3 87995643 missense probably damaging 1.00
R6495:Bcan UTSW 3 87996597 missense possibly damaging 0.91
R6725:Bcan UTSW 3 87995484 missense possibly damaging 0.69
R6764:Bcan UTSW 3 87988378 missense probably damaging 1.00
R7000:Bcan UTSW 3 87988379 nonsense probably null
R7294:Bcan UTSW 3 87995524 missense possibly damaging 0.51
R7338:Bcan UTSW 3 87994243 missense probably damaging 1.00
X0013:Bcan UTSW 3 87996159 missense possibly damaging 0.69
Z1176:Bcan UTSW 3 87990750 missense probably damaging 1.00
Z1176:Bcan UTSW 3 87990755 missense probably damaging 1.00
Z1176:Bcan UTSW 3 87995650 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGTGAGATGTGAGCTACAG -3'
(R):5'- CCCTACTTCCAGCTACATGG -3'

Sequencing Primer
(F):5'- CTACAGCAGAGGGCCCAAG -3'
(R):5'- AGCTACATGGGCCCCTGTG -3'
Posted On2016-10-24