Incidental Mutation 'R5544:Sel1l3'
ID436146
Institutional Source Beutler Lab
Gene Symbol Sel1l3
Ensembl Gene ENSMUSG00000029189
Gene Namesel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms2310045A20Rik
MMRRC Submission 043102-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5544 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location53107083-53213927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53200302 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 116 (V116D)
Ref Sequence ENSEMBL: ENSMUSP00000031090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031090]
Predicted Effect probably damaging
Transcript: ENSMUST00000031090
AA Change: V116D

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031090
Gene: ENSMUSG00000029189
AA Change: V116D

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
SEL1 575 609 3.39e1 SMART
SEL1 611 647 1.85e1 SMART
SEL1 694 730 5.27e-5 SMART
SEL1 732 767 2.94e-3 SMART
SEL1 768 800 5.32e-1 SMART
SEL1 801 839 1.23e-5 SMART
SEL1 840 877 8.55e1 SMART
SEL1 952 988 2.56e-3 SMART
low complexity region 1048 1058 N/A INTRINSIC
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1102 1127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199919
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 G A 9: 30,952,703 A372T probably damaging Het
Ap4m1 A G 5: 138,178,370 T411A probably benign Het
Arid3b T A 9: 57,798,097 K274* probably null Het
Bcan A G 3: 87,993,053 probably null Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
C9 T A 15: 6,497,027 V514D probably damaging Het
Cdk2 A C 10: 128,699,139 D336E probably benign Het
Corin A T 5: 72,305,014 Y825* probably null Het
Cyp17a1 A G 19: 46,672,654 Y64H probably damaging Het
Dock4 T G 12: 40,834,702 I1735S possibly damaging Het
Dock7 T C 4: 98,967,257 H1486R probably damaging Het
Fam171b C A 2: 83,855,527 A185D possibly damaging Het
Fbxl13 A G 5: 21,524,491 I441T probably damaging Het
Gm7347 T A 5: 26,055,018 D178V possibly damaging Het
Greb1 C A 12: 16,673,796 C1884F probably damaging Het
Kdr G A 5: 75,960,743 R536* probably null Het
Lamc2 T C 1: 153,124,053 T1187A possibly damaging Het
Mal T A 2: 127,635,017 H142L probably damaging Het
Map4k2 A C 19: 6,345,914 probably null Het
Morn4 T C 19: 42,076,247 T101A possibly damaging Het
Neto2 A G 8: 85,647,877 V241A possibly damaging Het
Nprl2 T C 9: 107,544,609 V232A probably benign Het
Pcdhb13 T C 18: 37,443,520 V317A possibly damaging Het
Pcdhb17 T A 18: 37,487,421 C755S possibly damaging Het
Pgc A G 17: 47,732,504 D259G probably benign Het
Ptprh C A 7: 4,580,910 E228* probably null Het
R3hdml A G 2: 163,498,422 T170A probably damaging Het
Retreg2 T G 1: 75,144,689 *174G probably null Het
Rps6ka1 A G 4: 133,872,015 S34P probably benign Het
Rptn A G 3: 93,398,473 T1038A possibly damaging Het
Sidt2 A T 9: 45,944,455 Y509N probably damaging Het
Slc16a11 T A 11: 70,215,000 probably null Het
Thsd7a G T 6: 12,379,471 Q985K possibly damaging Het
Ttn T C 2: 76,726,538 N30041S probably benign Het
Vmn1r231 A G 17: 20,890,578 I25T probably damaging Het
Wdr81 T C 11: 75,441,797 D1926G probably damaging Het
Other mutations in Sel1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Sel1l3 APN 5 53116333 missense probably damaging 0.96
IGL01585:Sel1l3 APN 5 53154236 missense probably damaging 0.99
IGL01717:Sel1l3 APN 5 53200168 missense probably damaging 0.99
IGL01771:Sel1l3 APN 5 53121841 missense probably damaging 0.99
IGL01926:Sel1l3 APN 5 53200143 missense probably benign 0.26
IGL01963:Sel1l3 APN 5 53200338 missense probably damaging 0.99
IGL02000:Sel1l3 APN 5 53145493 missense probably damaging 1.00
IGL02132:Sel1l3 APN 5 53170405 missense possibly damaging 0.89
IGL02198:Sel1l3 APN 5 53139799 splice site probably benign
IGL02930:Sel1l3 APN 5 53123217 missense possibly damaging 0.65
IGL03146:Sel1l3 APN 5 53154243 missense probably benign 0.00
IGL03175:Sel1l3 APN 5 53121857 missense probably damaging 1.00
R0083:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0108:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0108:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0940:Sel1l3 UTSW 5 53144037 splice site probably benign
R1027:Sel1l3 UTSW 5 53145478 missense possibly damaging 0.68
R1117:Sel1l3 UTSW 5 53172607 missense probably benign 0.00
R1145:Sel1l3 UTSW 5 53131827 missense probably damaging 0.99
R1145:Sel1l3 UTSW 5 53131827 missense probably damaging 0.99
R1146:Sel1l3 UTSW 5 53117103 missense possibly damaging 0.79
R1146:Sel1l3 UTSW 5 53117103 missense possibly damaging 0.79
R1345:Sel1l3 UTSW 5 53200217 missense possibly damaging 0.86
R1370:Sel1l3 UTSW 5 53200217 missense possibly damaging 0.86
R1503:Sel1l3 UTSW 5 53137929 missense probably damaging 0.98
R1747:Sel1l3 UTSW 5 53145545 missense possibly damaging 0.91
R1764:Sel1l3 UTSW 5 53170447 nonsense probably null
R2872:Sel1l3 UTSW 5 53137883 nonsense probably null
R2872:Sel1l3 UTSW 5 53137883 nonsense probably null
R3434:Sel1l3 UTSW 5 53117090 missense probably benign 0.44
R4043:Sel1l3 UTSW 5 53188054 nonsense probably null
R4074:Sel1l3 UTSW 5 53154287 missense probably damaging 0.99
R4727:Sel1l3 UTSW 5 53144183 critical splice acceptor site probably null
R4788:Sel1l3 UTSW 5 53131833 missense probably benign 0.41
R4900:Sel1l3 UTSW 5 53131842 missense probably damaging 1.00
R5000:Sel1l3 UTSW 5 53200434 missense probably damaging 0.97
R5090:Sel1l3 UTSW 5 53200046 missense probably benign 0.03
R5330:Sel1l3 UTSW 5 53186009 missense possibly damaging 0.80
R5456:Sel1l3 UTSW 5 53200036 missense probably benign 0.13
R5848:Sel1l3 UTSW 5 53184808 missense possibly damaging 0.91
R6132:Sel1l3 UTSW 5 53200189 missense possibly damaging 0.77
R6188:Sel1l3 UTSW 5 53155719 missense possibly damaging 0.70
R6622:Sel1l3 UTSW 5 53139860 missense probably damaging 0.98
R7015:Sel1l3 UTSW 5 53172574 missense probably benign 0.03
R7200:Sel1l3 UTSW 5 53144109 missense probably benign 0.22
R7271:Sel1l3 UTSW 5 53116362 missense probably damaging 0.98
R7378:Sel1l3 UTSW 5 53116409 missense probably benign 0.02
R7479:Sel1l3 UTSW 5 53117120 missense probably damaging 0.99
R7563:Sel1l3 UTSW 5 53185984 missense probably damaging 1.00
R7643:Sel1l3 UTSW 5 53123162 splice site probably null
R7741:Sel1l3 UTSW 5 53200251 missense probably damaging 1.00
R7743:Sel1l3 UTSW 5 53135885 missense probably benign 0.07
R7861:Sel1l3 UTSW 5 53144064 missense probably damaging 0.96
R7904:Sel1l3 UTSW 5 53139824 missense probably benign 0.24
R7944:Sel1l3 UTSW 5 53144064 missense probably damaging 0.96
R7987:Sel1l3 UTSW 5 53139824 missense probably benign 0.24
Z1088:Sel1l3 UTSW 5 53116196 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CGTGCAGCAAATTCTCCTCC -3'
(R):5'- TTCCAGAATTTTGTGCCATCG -3'

Sequencing Primer
(F):5'- CTGTGCCAGTGAGTAATCCAG -3'
(R):5'- ATCGTTGGGCAGGCAGACTTC -3'
Posted On2016-10-24