Mutagenetix > Incidental Mutation

Incidental Mutation 'R5544:Neto2'

436153

Institutional Source

Beutler Lab

Gene Symbol

Neto2

Ensembl Gene

ENSMUSG00000036902

Gene Name

neuropilin (NRP) and tolloid (TLL)-like 2

Synonyms

MMRRC Submission

043102-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.149) question?

Stock #

R5544 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85636588-85700924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85647877 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 241 (V241A)

Ref Sequence

ENSEMBL: ENSMUSP00000150062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]

AlphaFold

Q8BNJ6

Predicted Effect

probably benign
Transcript: ENSMUST00000109686
AA Change: V269A

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: V269A

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
CUB	80	194	2.56e-40	SMART
CUB	205	320	9.11e-5	SMART
LDLa	324	361	5.73e-5	SMART
transmembrane domain	374	396	N/A	INTRINSIC
coiled coil region	432	460	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209259

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209479
AA Change: V234A

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215046

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216286
AA Change: V241A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts8	G	A	9: 30,952,703	A372T	probably damaging	Het
Ap4m1	A	G	5: 138,178,370	T411A	probably benign	Het
Arid3b	T	A	9: 57,798,097	K274*	probably null	Het
Bcan	A	G	3: 87,993,053		probably null	Het
Birc6	A	C	17: 74,670,374	N4388T	probably damaging	Het
C9	T	A	15: 6,497,027	V514D	probably damaging	Het
Cdk2	A	C	10: 128,699,139	D336E	probably benign	Het
Corin	A	T	5: 72,305,014	Y825*	probably null	Het
Cyp17a1	A	G	19: 46,672,654	Y64H	probably damaging	Het
Dock4	T	G	12: 40,834,702	I1735S	possibly damaging	Het
Dock7	T	C	4: 98,967,257	H1486R	probably damaging	Het
Fam171b	C	A	2: 83,855,527	A185D	possibly damaging	Het
Fbxl13	A	G	5: 21,524,491	I441T	probably damaging	Het
Gm7347	T	A	5: 26,055,018	D178V	possibly damaging	Het
Greb1	C	A	12: 16,673,796	C1884F	probably damaging	Het
Kdr	G	A	5: 75,960,743	R536*	probably null	Het
Lamc2	T	C	1: 153,124,053	T1187A	possibly damaging	Het
Mal	T	A	2: 127,635,017	H142L	probably damaging	Het
Map4k2	A	C	19: 6,345,914		probably null	Het
Morn4	T	C	19: 42,076,247	T101A	possibly damaging	Het
Nprl2	T	C	9: 107,544,609	V232A	probably benign	Het
Pcdhb13	T	C	18: 37,443,520	V317A	possibly damaging	Het
Pcdhb17	T	A	18: 37,487,421	C755S	possibly damaging	Het
Pgc	A	G	17: 47,732,504	D259G	probably benign	Het
Ptprh	C	A	7: 4,580,910	E228*	probably null	Het
R3hdml	A	G	2: 163,498,422	T170A	probably damaging	Het
Retreg2	T	G	1: 75,144,689	*174G	probably null	Het
Rps6ka1	A	G	4: 133,872,015	S34P	probably benign	Het
Rptn	A	G	3: 93,398,473	T1038A	possibly damaging	Het
Sel1l3	A	T	5: 53,200,302	V116D	probably damaging	Het
Sidt2	A	T	9: 45,944,455	Y509N	probably damaging	Het
Slc16a11	T	A	11: 70,215,000		probably null	Het
Thsd7a	G	T	6: 12,379,471	Q985K	possibly damaging	Het
Ttn	T	C	2: 76,726,538	N30041S	probably benign	Het
Vmn1r231	A	G	17: 20,890,578	I25T	probably damaging	Het
Wdr81	T	C	11: 75,441,797	D1926G	probably damaging	Het

Other mutations in Neto2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01705:Neto2	APN	8	85641003	missense	probably damaging	1.00
IGL01938:Neto2	APN	8	85690855	missense	probably benign	0.00
IGL02238:Neto2	APN	8	85669663	missense	probably damaging	0.99
IGL02605:Neto2	APN	8	85663435	splice site	probably benign
IGL02813:Neto2	APN	8	85690886	missense	probably benign
R0138:Neto2	UTSW	8	85641044	missense	possibly damaging	0.72
R1934:Neto2	UTSW	8	85670404	missense	possibly damaging	0.96
R2402:Neto2	UTSW	8	85690912	missense	probably benign	0.00
R2423:Neto2	UTSW	8	85669767	missense	probably damaging	1.00
R3821:Neto2	UTSW	8	85663295	nonsense	probably null
R3822:Neto2	UTSW	8	85663295	nonsense	probably null
R3883:Neto2	UTSW	8	85663265	missense	probably damaging	1.00
R3939:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R3940:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R3941:Neto2	UTSW	8	85674118	missense	probably damaging	0.99
R4433:Neto2	UTSW	8	85641083	missense	probably damaging	1.00
R4668:Neto2	UTSW	8	85641062	missense	probably damaging	1.00
R4675:Neto2	UTSW	8	85669704	missense	probably damaging	1.00
R4908:Neto2	UTSW	8	85669764	missense	probably damaging	0.99
R5459:Neto2	UTSW	8	85670483	missense	probably benign	0.35
R5471:Neto2	UTSW	8	85640760	missense	probably benign	0.41
R5571:Neto2	UTSW	8	85640544	missense	probably damaging	1.00
R6083:Neto2	UTSW	8	85640585	missense	probably benign	0.00
R6339:Neto2	UTSW	8	85640558	missense	probably benign	0.33
R6381:Neto2	UTSW	8	85642509	missense	probably damaging	0.99
R6572:Neto2	UTSW	8	85670404	missense	possibly damaging	0.96
R6593:Neto2	UTSW	8	85669546	missense	probably damaging	1.00
R6662:Neto2	UTSW	8	85663215	missense	probably damaging	1.00
R6881:Neto2	UTSW	8	85640556	missense	probably damaging	1.00
R6950:Neto2	UTSW	8	85670443	missense	probably damaging	1.00
R7121:Neto2	UTSW	8	85670391	splice site	probably null
R7754:Neto2	UTSW	8	85669700	missense	probably damaging	0.98
R7755:Neto2	UTSW	8	85669656	missense	probably damaging	1.00
R8682:Neto2	UTSW	8	85640666	missense	probably benign	0.01
R9326:Neto2	UTSW	8	85642434	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCAAAAGGTAGGTATTCAGTAAGC -3'
(R):5'- TTCCTTTACCTGTTAATACCATGGG -3'

Sequencing Primer
(F):5'- TCAGTAAGCATATTGTGAATGAGTG -3'
(R):5'- GGAATATAAACACCTCTTAT -3'

Posted On

2016-10-24