Incidental Mutation 'R5544:Adamts8'
ID436154
Institutional Source Beutler Lab
Gene Symbol Adamts8
Ensembl Gene ENSMUSG00000031994
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8
SynonymsMETH-2, METH2
MMRRC Submission 043102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5544 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location30942562-30963838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30952703 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 372 (A372T)
Ref Sequence ENSEMBL: ENSMUSP00000069644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068135] [ENSMUST00000163037]
Predicted Effect probably damaging
Transcript: ENSMUST00000068135
AA Change: A372T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069644
Gene: ENSMUSG00000031994
AA Change: A372T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 152 6.4e-23 PFAM
Pfam:Reprolysin_5 232 418 1.3e-15 PFAM
Pfam:Reprolysin_4 233 435 3.4e-8 PFAM
Pfam:Reprolysin 234 444 3.8e-21 PFAM
Pfam:Reprolysin_2 252 434 1.3e-10 PFAM
Pfam:Reprolysin_3 255 389 7.4e-14 PFAM
TSP1 545 597 7.04e-14 SMART
Pfam:ADAM_spacer1 706 825 3.2e-35 PFAM
TSP1 851 904 5.35e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163037
SMART Domains Protein: ENSMUSP00000124848
Gene: ENSMUSG00000031994

DomainStartEndE-ValueType
PDB:2V4B|B 22 128 2e-38 PDB
SCOP:d1kufa_ 27 128 2e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214688
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is expressed in mouse lung, heart and macrophage-rich areas of atherosclerotic plaques. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. This gene is located adjacent to a related ADAMTS gene on chromosome 9. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4m1 A G 5: 138,178,370 T411A probably benign Het
Arid3b T A 9: 57,798,097 K274* probably null Het
Bcan A G 3: 87,993,053 probably null Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
C9 T A 15: 6,497,027 V514D probably damaging Het
Cdk2 A C 10: 128,699,139 D336E probably benign Het
Corin A T 5: 72,305,014 Y825* probably null Het
Cyp17a1 A G 19: 46,672,654 Y64H probably damaging Het
Dock4 T G 12: 40,834,702 I1735S possibly damaging Het
Dock7 T C 4: 98,967,257 H1486R probably damaging Het
Fam171b C A 2: 83,855,527 A185D possibly damaging Het
Fbxl13 A G 5: 21,524,491 I441T probably damaging Het
Gm7347 T A 5: 26,055,018 D178V possibly damaging Het
Greb1 C A 12: 16,673,796 C1884F probably damaging Het
Kdr G A 5: 75,960,743 R536* probably null Het
Lamc2 T C 1: 153,124,053 T1187A possibly damaging Het
Mal T A 2: 127,635,017 H142L probably damaging Het
Map4k2 A C 19: 6,345,914 probably null Het
Morn4 T C 19: 42,076,247 T101A possibly damaging Het
Neto2 A G 8: 85,647,877 V241A possibly damaging Het
Nprl2 T C 9: 107,544,609 V232A probably benign Het
Pcdhb13 T C 18: 37,443,520 V317A possibly damaging Het
Pcdhb17 T A 18: 37,487,421 C755S possibly damaging Het
Pgc A G 17: 47,732,504 D259G probably benign Het
Ptprh C A 7: 4,580,910 E228* probably null Het
R3hdml A G 2: 163,498,422 T170A probably damaging Het
Retreg2 T G 1: 75,144,689 *174G probably null Het
Rps6ka1 A G 4: 133,872,015 S34P probably benign Het
Rptn A G 3: 93,398,473 T1038A possibly damaging Het
Sel1l3 A T 5: 53,200,302 V116D probably damaging Het
Sidt2 A T 9: 45,944,455 Y509N probably damaging Het
Slc16a11 T A 11: 70,215,000 probably null Het
Thsd7a G T 6: 12,379,471 Q985K possibly damaging Het
Ttn T C 2: 76,726,538 N30041S probably benign Het
Vmn1r231 A G 17: 20,890,578 I25T probably damaging Het
Wdr81 T C 11: 75,441,797 D1926G probably damaging Het
Other mutations in Adamts8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Adamts8 APN 9 30953500 missense probably damaging 1.00
IGL02049:Adamts8 APN 9 30951354 missense probably damaging 0.96
IGL02304:Adamts8 APN 9 30956656 missense possibly damaging 0.55
IGL02385:Adamts8 APN 9 30961730 missense probably benign 0.10
IGL02536:Adamts8 APN 9 30962072 missense probably benign 0.05
IGL03347:Adamts8 APN 9 30959238 missense possibly damaging 0.75
R0633:Adamts8 UTSW 9 30943511 missense probably damaging 1.00
R1066:Adamts8 UTSW 9 30956541 missense probably damaging 1.00
R1464:Adamts8 UTSW 9 30951377 missense probably benign
R1464:Adamts8 UTSW 9 30951377 missense probably benign
R1560:Adamts8 UTSW 9 30956667 missense probably damaging 1.00
R1592:Adamts8 UTSW 9 30943176 missense probably damaging 0.99
R1753:Adamts8 UTSW 9 30954614 missense probably benign 0.04
R1932:Adamts8 UTSW 9 30956512 missense probably benign
R2087:Adamts8 UTSW 9 30962112 missense probably damaging 1.00
R2118:Adamts8 UTSW 9 30943063 missense probably damaging 1.00
R3789:Adamts8 UTSW 9 30959292 missense probably damaging 1.00
R4165:Adamts8 UTSW 9 30951388 missense probably benign 0.01
R4166:Adamts8 UTSW 9 30951388 missense probably benign 0.01
R4193:Adamts8 UTSW 9 30959308 missense probably damaging 1.00
R4425:Adamts8 UTSW 9 30956656 missense possibly damaging 0.55
R5155:Adamts8 UTSW 9 30954548 missense probably benign 0.33
R5433:Adamts8 UTSW 9 30961716 missense probably benign 0.01
R5590:Adamts8 UTSW 9 30951336 missense probably damaging 0.97
R5640:Adamts8 UTSW 9 30956500 missense probably benign 0.00
R5800:Adamts8 UTSW 9 30954482 missense probably damaging 1.00
R5909:Adamts8 UTSW 9 30961928 missense probably benign 0.00
R6821:Adamts8 UTSW 9 30956626 missense probably benign 0.08
R6967:Adamts8 UTSW 9 30954491 missense probably benign 0.04
R7336:Adamts8 UTSW 9 30962067 missense probably benign 0.00
R7538:Adamts8 UTSW 9 30953470 missense probably damaging 1.00
R7540:Adamts8 UTSW 9 30959064 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACACTGGGCACTTACCTCTG -3'
(R):5'- AGGACACCAATTTAGCACTTTG -3'

Sequencing Primer
(F):5'- GGGCACTTACCTCTGGTCTC -3'
(R):5'- GTCGGTAACATCAAGTATAGCATG -3'
Posted On2016-10-24