Incidental Mutation 'R5544:Wdr81'
ID436160
Institutional Source Beutler Lab
Gene Symbol Wdr81
Ensembl Gene ENSMUSG00000045374
Gene NameWD repeat domain 81
SynonymsMGC32441
MMRRC Submission 043102-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5544 (G1)
Quality Score172
Status Not validated
Chromosome11
Chromosomal Location75440944-75454717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75441797 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1926 (D1926G)
Ref Sequence ENSEMBL: ENSMUSP00000134266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043696] [ENSMUST00000108437] [ENSMUST00000128330] [ENSMUST00000142094] [ENSMUST00000173320]
Predicted Effect probably benign
Transcript: ENSMUST00000043696
SMART Domains Protein: ENSMUSP00000048704
Gene: ENSMUSG00000038224

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 91 436 1.5e-137 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108437
SMART Domains Protein: ENSMUSP00000104076
Gene: ENSMUSG00000038224

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 91 436 1.5e-137 SMART
Predicted Effect unknown
Transcript: ENSMUST00000117392
AA Change: D1925G
SMART Domains Protein: ENSMUSP00000113939
Gene: ENSMUSG00000045374
AA Change: D1925G

DomainStartEndE-ValueType
Beach 347 589 2.52e-98 SMART
low complexity region 673 704 N/A INTRINSIC
low complexity region 848 874 N/A INTRINSIC
low complexity region 1141 1165 N/A INTRINSIC
low complexity region 1196 1210 N/A INTRINSIC
low complexity region 1566 1587 N/A INTRINSIC
WD40 1630 1669 3.19e-7 SMART
WD40 1679 1716 1.18e2 SMART
WD40 1719 1761 7.36e1 SMART
WD40 1764 1807 3.3e1 SMART
WD40 1810 1848 3.58e-1 SMART
WD40 1893 1934 4.26e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128330
SMART Domains Protein: ENSMUSP00000114450
Gene: ENSMUSG00000038224

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 91 280 1.07e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000132442
AA Change: D747G
SMART Domains Protein: ENSMUSP00000120605
Gene: ENSMUSG00000045374
AA Change: D747G

DomainStartEndE-ValueType
low complexity region 1 7 N/A INTRINSIC
low complexity region 23 47 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
WD40 512 551 3.19e-7 SMART
WD40 561 598 1.18e2 SMART
WD40 601 670 3.55e1 SMART
Blast:WD40 673 710 3e-14 BLAST
WD40 715 756 4.26e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142094
SMART Domains Protein: ENSMUSP00000120812
Gene: ENSMUSG00000038224

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173320
AA Change: D1926G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134266
Gene: ENSMUSG00000045374
AA Change: D1926G

DomainStartEndE-ValueType
Beach 347 589 2.52e-98 SMART
low complexity region 673 704 N/A INTRINSIC
low complexity region 848 874 N/A INTRINSIC
low complexity region 1141 1165 N/A INTRINSIC
low complexity region 1196 1210 N/A INTRINSIC
low complexity region 1566 1587 N/A INTRINSIC
WD40 1630 1669 3.19e-7 SMART
WD40 1679 1716 1.18e2 SMART
WD40 1719 1761 7.36e1 SMART
WD40 1764 1807 3.3e1 SMART
WD40 1810 1848 3.58e-1 SMART
WD40 1893 1934 4.26e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain transmembrane protein, which is predominantly expressed in the brain. Mutations in this gene are associated with autosomal recessive cerebellar ataxia, mental retardation, and dysequilibrium syndrome-2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit weight loss, tremors, ataxia and an abnormal gait, as well as abnormal mitochondria in Purkinje cell dendrites, Purkinje cell degeneration, photoreceptor cell loss, and decreased total retina thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 G A 9: 30,952,703 A372T probably damaging Het
Ap4m1 A G 5: 138,178,370 T411A probably benign Het
Arid3b T A 9: 57,798,097 K274* probably null Het
Bcan A G 3: 87,993,053 probably null Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
C9 T A 15: 6,497,027 V514D probably damaging Het
Cdk2 A C 10: 128,699,139 D336E probably benign Het
Corin A T 5: 72,305,014 Y825* probably null Het
Cyp17a1 A G 19: 46,672,654 Y64H probably damaging Het
Dock4 T G 12: 40,834,702 I1735S possibly damaging Het
Dock7 T C 4: 98,967,257 H1486R probably damaging Het
Fam171b C A 2: 83,855,527 A185D possibly damaging Het
Fbxl13 A G 5: 21,524,491 I441T probably damaging Het
Gm7347 T A 5: 26,055,018 D178V possibly damaging Het
Greb1 C A 12: 16,673,796 C1884F probably damaging Het
Kdr G A 5: 75,960,743 R536* probably null Het
Lamc2 T C 1: 153,124,053 T1187A possibly damaging Het
Mal T A 2: 127,635,017 H142L probably damaging Het
Map4k2 A C 19: 6,345,914 probably null Het
Morn4 T C 19: 42,076,247 T101A possibly damaging Het
Neto2 A G 8: 85,647,877 V241A possibly damaging Het
Nprl2 T C 9: 107,544,609 V232A probably benign Het
Pcdhb13 T C 18: 37,443,520 V317A possibly damaging Het
Pcdhb17 T A 18: 37,487,421 C755S possibly damaging Het
Pgc A G 17: 47,732,504 D259G probably benign Het
Ptprh C A 7: 4,580,910 E228* probably null Het
R3hdml A G 2: 163,498,422 T170A probably damaging Het
Retreg2 T G 1: 75,144,689 *174G probably null Het
Rps6ka1 A G 4: 133,872,015 S34P probably benign Het
Rptn A G 3: 93,398,473 T1038A possibly damaging Het
Sel1l3 A T 5: 53,200,302 V116D probably damaging Het
Sidt2 A T 9: 45,944,455 Y509N probably damaging Het
Slc16a11 T A 11: 70,215,000 probably null Het
Thsd7a G T 6: 12,379,471 Q985K possibly damaging Het
Ttn T C 2: 76,726,538 N30041S probably benign Het
Vmn1r231 A G 17: 20,890,578 I25T probably damaging Het
Other mutations in Wdr81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Wdr81 APN 11 75445601 missense probably damaging 1.00
IGL02047:Wdr81 APN 11 75445506 missense probably damaging 1.00
IGL02103:Wdr81 APN 11 75444720 missense probably damaging 1.00
IGL02506:Wdr81 APN 11 75444406 missense probably benign 0.44
jello UTSW 11 75441812 missense probably damaging 1.00
R1184:Wdr81 UTSW 11 75452983 missense probably damaging 1.00
R1560:Wdr81 UTSW 11 75451623 nonsense probably null
R1680:Wdr81 UTSW 11 75454423 missense probably benign
R1689:Wdr81 UTSW 11 75445596 missense probably damaging 0.99
R2021:Wdr81 UTSW 11 75445962 nonsense probably null
R2104:Wdr81 UTSW 11 75452983 missense probably damaging 1.00
R2113:Wdr81 UTSW 11 75453635 missense probably benign 0.07
R2198:Wdr81 UTSW 11 75446081 missense probably benign 0.00
R2393:Wdr81 UTSW 11 75449405 missense probably damaging 1.00
R2400:Wdr81 UTSW 11 75449035 missense probably benign
R2850:Wdr81 UTSW 11 75451172 missense probably damaging 1.00
R3410:Wdr81 UTSW 11 75452932 missense probably damaging 0.97
R3764:Wdr81 UTSW 11 75452803 missense probably damaging 1.00
R4223:Wdr81 UTSW 11 75448002 missense probably benign 0.00
R4351:Wdr81 UTSW 11 75441812 missense probably damaging 1.00
R4594:Wdr81 UTSW 11 75445794 missense probably benign 0.00
R4601:Wdr81 UTSW 11 75445658 missense probably damaging 1.00
R4647:Wdr81 UTSW 11 75445988 missense probably damaging 0.98
R4651:Wdr81 UTSW 11 75451240 missense probably damaging 0.99
R4652:Wdr81 UTSW 11 75451240 missense probably damaging 0.99
R4930:Wdr81 UTSW 11 75451924 missense probably benign
R4966:Wdr81 UTSW 11 75445949 missense probably benign 0.34
R5075:Wdr81 UTSW 11 75452481 missense probably benign 0.00
R5412:Wdr81 UTSW 11 75450794 missense probably null 1.00
R5426:Wdr81 UTSW 11 75450896 missense possibly damaging 0.87
R5540:Wdr81 UTSW 11 75449070 missense probably damaging 1.00
R5632:Wdr81 UTSW 11 75445906 missense probably damaging 0.99
R5650:Wdr81 UTSW 11 75444748 missense probably damaging 1.00
R5679:Wdr81 UTSW 11 75452923 missense probably damaging 1.00
R5978:Wdr81 UTSW 11 75444398 missense probably damaging 1.00
R6031:Wdr81 UTSW 11 75447869 missense probably damaging 1.00
R6031:Wdr81 UTSW 11 75447869 missense probably damaging 1.00
R6412:Wdr81 UTSW 11 75451163 missense probably benign 0.16
R6479:Wdr81 UTSW 11 75452105 missense possibly damaging 0.92
R6992:Wdr81 UTSW 11 75451786 missense probably benign 0.00
R7148:Wdr81 UTSW 11 75446002 missense
R7340:Wdr81 UTSW 11 75444699 missense probably null
R7739:Wdr81 UTSW 11 75441985 missense
R7823:Wdr81 UTSW 11 75449801 missense probably damaging 1.00
R7898:Wdr81 UTSW 11 75453899 missense probably benign
R7981:Wdr81 UTSW 11 75453899 missense probably benign
Z1176:Wdr81 UTSW 11 75449885 missense
Z1176:Wdr81 UTSW 11 75451947 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTAGGAACAGTATCTCCCGAG -3'
(R):5'- ACCTTTGACCTGTACGGCAG -3'

Sequencing Primer
(F):5'- GGAACAGTATCTCCCGAGTTTCATG -3'
(R):5'- TGTACGGCAGCGAGGTG -3'
Posted On2016-10-24