Incidental Mutation 'R5544:Pcdhb13'
ID436168
Institutional Source Beutler Lab
Gene Symbol Pcdhb13
Ensembl Gene ENSMUSG00000047307
Gene Nameprotocadherin beta 13
SynonymsPcdhbM, Pcdbh6
MMRRC Submission 043102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5544 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37442500-37446209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37443520 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 317 (V317A)
Ref Sequence ENSEMBL: ENSMUSP00000061087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052387] [ENSMUST00000055495] [ENSMUST00000056915] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000052387
SMART Domains Protein: ENSMUSP00000054111
Gene: ENSMUSG00000044043

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 1.4e-35 PFAM
CA 155 240 1.53e-20 SMART
CA 264 345 3.52e-29 SMART
CA 368 449 2.24e-22 SMART
CA 473 559 2.38e-26 SMART
CA 589 670 4.12e-12 SMART
Pfam:Cadherin_C_2 685 768 4.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055495
SMART Domains Protein: ENSMUSP00000050357
Gene: ENSMUSG00000043458

DomainStartEndE-ValueType
CA 53 130 1.67e-1 SMART
CA 154 239 3.69e-23 SMART
CA 263 343 6.56e-29 SMART
CA 366 447 5.9e-22 SMART
CA 471 557 4.24e-23 SMART
CA 587 668 1.01e-11 SMART
Pfam:Cadherin_C_2 685 768 4.8e-26 PFAM
low complexity region 778 790 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000056915
AA Change: V317A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061087
Gene: ENSMUSG00000047307
AA Change: V317A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 58 130 5.5e-1 SMART
CA 154 239 8.55e-19 SMART
CA 263 343 3.36e-26 SMART
CA 366 447 2.24e-22 SMART
CA 471 557 1.08e-24 SMART
CA 587 668 1.25e-11 SMART
Pfam:Cadherin_C_2 685 768 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. Unlike the alpha and gamma clusters, the transcripts from these genes do not share common 3' exons. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell neural connections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 G A 9: 30,952,703 A372T probably damaging Het
Ap4m1 A G 5: 138,178,370 T411A probably benign Het
Arid3b T A 9: 57,798,097 K274* probably null Het
Bcan A G 3: 87,993,053 probably null Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
C9 T A 15: 6,497,027 V514D probably damaging Het
Cdk2 A C 10: 128,699,139 D336E probably benign Het
Corin A T 5: 72,305,014 Y825* probably null Het
Cyp17a1 A G 19: 46,672,654 Y64H probably damaging Het
Dock4 T G 12: 40,834,702 I1735S possibly damaging Het
Dock7 T C 4: 98,967,257 H1486R probably damaging Het
Fam171b C A 2: 83,855,527 A185D possibly damaging Het
Fbxl13 A G 5: 21,524,491 I441T probably damaging Het
Gm7347 T A 5: 26,055,018 D178V possibly damaging Het
Greb1 C A 12: 16,673,796 C1884F probably damaging Het
Kdr G A 5: 75,960,743 R536* probably null Het
Lamc2 T C 1: 153,124,053 T1187A possibly damaging Het
Mal T A 2: 127,635,017 H142L probably damaging Het
Map4k2 A C 19: 6,345,914 probably null Het
Morn4 T C 19: 42,076,247 T101A possibly damaging Het
Neto2 A G 8: 85,647,877 V241A possibly damaging Het
Nprl2 T C 9: 107,544,609 V232A probably benign Het
Pcdhb17 T A 18: 37,487,421 C755S possibly damaging Het
Pgc A G 17: 47,732,504 D259G probably benign Het
Ptprh C A 7: 4,580,910 E228* probably null Het
R3hdml A G 2: 163,498,422 T170A probably damaging Het
Retreg2 T G 1: 75,144,689 *174G probably null Het
Rps6ka1 A G 4: 133,872,015 S34P probably benign Het
Rptn A G 3: 93,398,473 T1038A possibly damaging Het
Sel1l3 A T 5: 53,200,302 V116D probably damaging Het
Sidt2 A T 9: 45,944,455 Y509N probably damaging Het
Slc16a11 T A 11: 70,215,000 probably null Het
Thsd7a G T 6: 12,379,471 Q985K possibly damaging Het
Ttn T C 2: 76,726,538 N30041S probably benign Het
Vmn1r231 A G 17: 20,890,578 I25T probably damaging Het
Wdr81 T C 11: 75,441,797 D1926G probably damaging Het
Other mutations in Pcdhb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Pcdhb13 APN 18 37443721 missense possibly damaging 0.56
IGL00718:Pcdhb13 APN 18 37444821 missense possibly damaging 0.91
IGL01143:Pcdhb13 APN 18 37442637 missense probably benign 0.01
IGL01816:Pcdhb13 APN 18 37442975 missense probably benign 0.00
IGL01916:Pcdhb13 APN 18 37443861 missense possibly damaging 0.64
IGL02063:Pcdhb13 APN 18 37444229 missense probably damaging 1.00
IGL02153:Pcdhb13 APN 18 37443685 missense probably damaging 1.00
IGL02332:Pcdhb13 APN 18 37443582 missense probably benign 0.32
IGL02407:Pcdhb13 APN 18 37443075 missense probably damaging 1.00
IGL02423:Pcdhb13 APN 18 37444339 missense possibly damaging 0.95
IGL02514:Pcdhb13 APN 18 37442991 missense possibly damaging 0.80
IGL03025:Pcdhb13 APN 18 37442764 missense probably damaging 1.00
IGL03227:Pcdhb13 APN 18 37443658 missense probably damaging 0.98
IGL03233:Pcdhb13 APN 18 37444265 missense probably damaging 0.96
IGL03239:Pcdhb13 APN 18 37442835 missense probably damaging 0.97
R0046:Pcdhb13 UTSW 18 37444257 missense probably benign
R0172:Pcdhb13 UTSW 18 37442937 missense probably benign 0.00
R0201:Pcdhb13 UTSW 18 37442581 missense probably benign
R0594:Pcdhb13 UTSW 18 37443931 missense probably damaging 1.00
R1235:Pcdhb13 UTSW 18 37444959 makesense probably null
R1292:Pcdhb13 UTSW 18 37443832 missense probably benign 0.43
R1481:Pcdhb13 UTSW 18 37442836 missense probably damaging 1.00
R1991:Pcdhb13 UTSW 18 37443859 missense possibly damaging 0.80
R2058:Pcdhb13 UTSW 18 37444567 missense possibly damaging 0.95
R3508:Pcdhb13 UTSW 18 37443151 missense probably damaging 0.99
R3713:Pcdhb13 UTSW 18 37443733 missense probably damaging 1.00
R4125:Pcdhb13 UTSW 18 37443820 missense probably damaging 1.00
R4741:Pcdhb13 UTSW 18 37443518 missense probably benign 0.01
R4747:Pcdhb13 UTSW 18 37444815 missense probably damaging 0.99
R4957:Pcdhb13 UTSW 18 37444784 missense possibly damaging 0.95
R4973:Pcdhb13 UTSW 18 37443184 missense probably benign 0.20
R5354:Pcdhb13 UTSW 18 37444791 missense probably damaging 1.00
R5364:Pcdhb13 UTSW 18 37443508 missense probably damaging 1.00
R5897:Pcdhb13 UTSW 18 37443211 missense probably benign 0.42
R6174:Pcdhb13 UTSW 18 37443421 missense possibly damaging 0.84
R6702:Pcdhb13 UTSW 18 37444775 missense probably benign 0.42
R6765:Pcdhb13 UTSW 18 37443610 missense probably damaging 1.00
R6960:Pcdhb13 UTSW 18 37443456 missense probably benign 0.45
R7144:Pcdhb13 UTSW 18 37443256 missense probably damaging 1.00
R7225:Pcdhb13 UTSW 18 37444437 missense possibly damaging 0.91
R7239:Pcdhb13 UTSW 18 37444644 missense probably damaging 0.99
R7437:Pcdhb13 UTSW 18 37444675 missense probably damaging 1.00
R7812:Pcdhb13 UTSW 18 37442592 missense probably benign 0.00
X0023:Pcdhb13 UTSW 18 37443013 missense probably damaging 1.00
X0028:Pcdhb13 UTSW 18 37444642 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACAGTCCCATTGGCTCACTG -3'
(R):5'- CGGAAGATTGTCATCTATGGAAC -3'

Sequencing Primer
(F):5'- CACTGCTTATTACAGTCTCAGCAAG -3'
(R):5'- TGGAACACATAACCTGCTGG -3'
Posted On2016-10-24