Incidental Mutation 'R5544:Cyp17a1'
ID 436172
Institutional Source Beutler Lab
Gene Symbol Cyp17a1
Ensembl Gene ENSMUSG00000003555
Gene Name cytochrome P450, family 17, subfamily a, polypeptide 1
Synonyms p450c17, Cyp17, steroid 17-alpha hydroxylase
MMRRC Submission 043102-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R5544 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 46655604-46661439 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46661093 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 64 (Y64H)
Ref Sequence ENSEMBL: ENSMUSP00000026012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026012]
AlphaFold P27786
Predicted Effect probably damaging
Transcript: ENSMUST00000026012
AA Change: Y64H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: Y64H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:p450 28 492 2.6e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182599
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 G A 9: 30,863,999 (GRCm39) A372T probably damaging Het
Ap4m1 A G 5: 138,176,632 (GRCm39) T411A probably benign Het
Arid3b T A 9: 57,705,380 (GRCm39) K274* probably null Het
Bcan A G 3: 87,900,360 (GRCm39) probably null Het
Birc6 A C 17: 74,977,369 (GRCm39) N4388T probably damaging Het
C9 T A 15: 6,526,508 (GRCm39) V514D probably damaging Het
Cdk2 A C 10: 128,535,008 (GRCm39) D336E probably benign Het
Corin A T 5: 72,462,357 (GRCm39) Y825* probably null Het
Dock4 T G 12: 40,884,701 (GRCm39) I1735S possibly damaging Het
Dock7 T C 4: 98,855,494 (GRCm39) H1486R probably damaging Het
Fam171b C A 2: 83,685,871 (GRCm39) A185D possibly damaging Het
Fbxl13 A G 5: 21,729,489 (GRCm39) I441T probably damaging Het
Gm7347 T A 5: 26,260,016 (GRCm39) D178V possibly damaging Het
Greb1 C A 12: 16,723,797 (GRCm39) C1884F probably damaging Het
Kdr G A 5: 76,121,403 (GRCm39) R536* probably null Het
Lamc2 T C 1: 152,999,799 (GRCm39) T1187A possibly damaging Het
Mal T A 2: 127,476,937 (GRCm39) H142L probably damaging Het
Map4k2 A C 19: 6,395,944 (GRCm39) probably null Het
Morn4 T C 19: 42,064,686 (GRCm39) T101A possibly damaging Het
Neto2 A G 8: 86,374,506 (GRCm39) V241A possibly damaging Het
Nprl2 T C 9: 107,421,808 (GRCm39) V232A probably benign Het
Pcdhb13 T C 18: 37,576,573 (GRCm39) V317A possibly damaging Het
Pcdhb17 T A 18: 37,620,474 (GRCm39) C755S possibly damaging Het
Pgc A G 17: 48,043,429 (GRCm39) D259G probably benign Het
Ptprh C A 7: 4,583,909 (GRCm39) E228* probably null Het
R3hdml A G 2: 163,340,342 (GRCm39) T170A probably damaging Het
Retreg2 T G 1: 75,121,333 (GRCm39) *174G probably null Het
Rps6ka1 A G 4: 133,599,326 (GRCm39) S34P probably benign Het
Rptn A G 3: 93,305,780 (GRCm39) T1038A possibly damaging Het
Sel1l3 A T 5: 53,357,644 (GRCm39) V116D probably damaging Het
Sidt2 A T 9: 45,855,753 (GRCm39) Y509N probably damaging Het
Slc16a11 T A 11: 70,105,826 (GRCm39) probably null Het
Thsd7a G T 6: 12,379,470 (GRCm39) Q985K possibly damaging Het
Ttn T C 2: 76,556,882 (GRCm39) N30041S probably benign Het
Vmn1r231 A G 17: 21,110,840 (GRCm39) I25T probably damaging Het
Wdr81 T C 11: 75,332,623 (GRCm39) D1926G probably damaging Het
Other mutations in Cyp17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Cyp17a1 APN 19 46,659,495 (GRCm39) missense probably benign 0.00
IGL01839:Cyp17a1 APN 19 46,659,110 (GRCm39) missense possibly damaging 0.89
IGL01901:Cyp17a1 APN 19 46,659,531 (GRCm39) missense possibly damaging 0.64
IGL02033:Cyp17a1 APN 19 46,661,046 (GRCm39) nonsense probably null
IGL02349:Cyp17a1 APN 19 46,655,936 (GRCm39) missense probably damaging 1.00
IGL02663:Cyp17a1 APN 19 46,661,005 (GRCm39) missense probably damaging 1.00
IGL02883:Cyp17a1 APN 19 46,657,790 (GRCm39) missense probably benign 0.00
IGL03092:Cyp17a1 APN 19 46,661,050 (GRCm39) missense possibly damaging 0.79
IGL03239:Cyp17a1 APN 19 46,655,796 (GRCm39) missense probably damaging 1.00
IGL03336:Cyp17a1 APN 19 46,659,474 (GRCm39) missense probably benign 0.00
R3773:Cyp17a1 UTSW 19 46,658,162 (GRCm39) missense probably damaging 0.97
R4445:Cyp17a1 UTSW 19 46,656,462 (GRCm39) missense probably damaging 1.00
R4446:Cyp17a1 UTSW 19 46,656,462 (GRCm39) missense probably damaging 1.00
R4572:Cyp17a1 UTSW 19 46,658,990 (GRCm39) missense probably damaging 1.00
R5730:Cyp17a1 UTSW 19 46,661,095 (GRCm39) missense possibly damaging 0.49
R6163:Cyp17a1 UTSW 19 46,657,761 (GRCm39) missense possibly damaging 0.69
R6271:Cyp17a1 UTSW 19 46,661,159 (GRCm39) missense probably benign 0.17
R6728:Cyp17a1 UTSW 19 46,657,673 (GRCm39) missense probably benign
R6729:Cyp17a1 UTSW 19 46,659,020 (GRCm39) missense probably benign
R7025:Cyp17a1 UTSW 19 46,659,419 (GRCm39) missense probably damaging 0.98
R7395:Cyp17a1 UTSW 19 46,659,134 (GRCm39) missense probably benign
R8056:Cyp17a1 UTSW 19 46,659,030 (GRCm39) missense possibly damaging 0.95
R8308:Cyp17a1 UTSW 19 46,656,516 (GRCm39) missense probably benign 0.09
R8735:Cyp17a1 UTSW 19 46,659,533 (GRCm39) critical splice acceptor site probably null
R8737:Cyp17a1 UTSW 19 46,658,166 (GRCm39) missense probably benign 0.09
R9091:Cyp17a1 UTSW 19 46,656,030 (GRCm39) missense probably benign 0.00
R9270:Cyp17a1 UTSW 19 46,656,030 (GRCm39) missense probably benign 0.00
R9364:Cyp17a1 UTSW 19 46,657,165 (GRCm39) missense probably damaging 1.00
R9554:Cyp17a1 UTSW 19 46,657,165 (GRCm39) missense probably damaging 1.00
X0020:Cyp17a1 UTSW 19 46,659,459 (GRCm39) missense possibly damaging 0.88
Z1177:Cyp17a1 UTSW 19 46,661,098 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCCAGTTTAGAGGTTCGGTAGG -3'
(R):5'- CTGCCATGTGGGAACTTGTG -3'

Sequencing Primer
(F):5'- GAGCAGTCCCACAAGTCTGATTTTG -3'
(R):5'- GTGGGTCTCTTGCTGCTCATC -3'
Posted On 2016-10-24