Incidental Mutation 'R5545:Scrn3'
ID436178
Institutional Source Beutler Lab
Gene Symbol Scrn3
Ensembl Gene ENSMUSG00000008226
Gene Namesecernin 3
Synonyms4833415E20Rik
MMRRC Submission 043103-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5545 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location73312601-73337818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73335781 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 386 (I386N)
Ref Sequence ENSEMBL: ENSMUSP00000088320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090811]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090811
AA Change: I386N

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000088320
Gene: ENSMUSG00000008226
AA Change: I386N

DomainStartEndE-ValueType
Pfam:Peptidase_C69 50 268 4.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123621
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T C 3: 145,939,098 probably null Het
Acot5 G A 12: 84,069,606 R47Q possibly damaging Het
Akr1c19 A T 13: 4,242,595 Y205F probably benign Het
Cdh6 T C 15: 13,041,149 Y564C probably damaging Het
Cngb1 A G 8: 95,252,173 S551P probably damaging Het
Cyp20a1 T C 1: 60,376,082 I289T possibly damaging Het
Gm17677 A G 9: 35,741,644 I61V probably benign Het
Herc6 A T 6: 57,658,007 probably null Het
Ifnar2 G A 16: 91,385,025 probably null Het
Kcnd2 A G 6: 21,217,019 T241A probably damaging Het
Nfatc2ip T A 7: 126,390,470 E247D possibly damaging Het
Olfr1394 G A 11: 49,160,626 C204Y probably damaging Het
Olfr267 T G 4: 58,785,585 I46L probably benign Het
Plekhg2 T C 7: 28,362,461 E638G probably damaging Het
Plin1 T C 7: 79,726,509 T160A probably benign Het
Prox1 T A 1: 190,147,142 N613I probably damaging Het
Ptpn13 A G 5: 103,561,964 S1498G probably damaging Het
Ralbp1 C T 17: 65,850,104 R598Q possibly damaging Het
Robo2 A C 16: 73,961,747 V712G probably damaging Het
Rsl1d1 A G 16: 11,199,650 F151L probably damaging Het
Sorl1 T A 9: 41,991,625 Y1591F probably benign Het
Tbr1 T G 2: 61,807,376 V93G possibly damaging Het
Tmem229b A G 12: 78,964,809 I116T probably damaging Het
Ttn T C 2: 76,764,376 Q12115R possibly damaging Het
Ube3a C T 7: 59,272,024 T48M probably damaging Het
Vnn3 A G 10: 23,867,094 I401V probably benign Het
Wdr90 C T 17: 25,845,856 R1744H probably damaging Het
Zc3h7a T C 16: 11,148,451 D604G possibly damaging Het
Other mutations in Scrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02012:Scrn3 APN 2 73318429 critical splice donor site probably null
IGL02676:Scrn3 APN 2 73329871 missense probably benign
PIT4445001:Scrn3 UTSW 2 73318329 missense possibly damaging 0.90
PIT4519001:Scrn3 UTSW 2 73318424 missense possibly damaging 0.78
PIT4519001:Scrn3 UTSW 2 73331003 missense possibly damaging 0.95
R2105:Scrn3 UTSW 2 73329852 missense probably damaging 0.96
R3973:Scrn3 UTSW 2 73335777 missense possibly damaging 0.66
R3974:Scrn3 UTSW 2 73335777 missense possibly damaging 0.66
R3975:Scrn3 UTSW 2 73335777 missense possibly damaging 0.66
R4206:Scrn3 UTSW 2 73319501 critical splice donor site probably null
R5340:Scrn3 UTSW 2 73335810 nonsense probably null
R5852:Scrn3 UTSW 2 73331005 missense probably damaging 1.00
R6819:Scrn3 UTSW 2 73319482 missense probably damaging 0.98
R7664:Scrn3 UTSW 2 73319370 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGCTGCCTGTTCATTGGTACC -3'
(R):5'- TAATCAGATCTCCTTAGCATAGCTC -3'

Sequencing Primer
(F):5'- CTGAAGGTCCTGAGTTAAATCCCAG -3'
(R):5'- GCTCTATATCATTACCAGGGCAGTG -3'
Posted On2016-10-24