Incidental Mutation 'R5532:Teddm2'
ID436206
Institutional Source Beutler Lab
Gene Symbol Teddm2
Ensembl Gene ENSMUSG00000045968
Gene Nametransmembrane epididymal family member 2
Synonymse9-2, 5830403L16Rik
MMRRC Submission 043090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5532 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location153849542-153900228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 153850384 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 195 (V195D)
Ref Sequence ENSEMBL: ENSMUSP00000115023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059607] [ENSMUST00000123490]
Predicted Effect probably benign
Transcript: ENSMUST00000059607
AA Change: V248D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000050017
Gene: ENSMUSG00000045968
AA Change: V248D

DomainStartEndE-ValueType
Pfam:DUF716 126 247 1.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123490
AA Change: V195D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000115023
Gene: ENSMUSG00000045968
AA Change: V195D

DomainStartEndE-ValueType
Pfam:DUF716 71 195 6.1e-36 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
A2ml1 T A 6: 128,553,330 probably null Het
Adsl C G 15: 80,963,909 P118A probably damaging Het
Ano6 C T 15: 95,962,241 P748L probably damaging Het
Arhgap10 A T 8: 77,420,072 N234K probably benign Het
Arhgap18 T A 10: 26,846,108 I25K possibly damaging Het
AW551984 T C 9: 39,597,185 Y345C probably damaging Het
Ccdc146 A G 5: 21,305,331 V561A probably benign Het
Cenpv G A 11: 62,527,572 T185M probably damaging Het
Fat2 T A 11: 55,262,337 D3683V probably damaging Het
Galns T C 8: 122,585,026 D415G possibly damaging Het
Gatad2a G A 8: 69,916,420 T259M probably damaging Het
Gja8 T C 3: 96,920,332 S5G probably benign Het
Gm13119 A T 4: 144,363,491 D367V probably damaging Het
Gm4951 A G 18: 60,246,070 I226V probably benign Het
Ifi209 T C 1: 173,638,976 S125P probably damaging Het
Il12rb2 G A 6: 67,292,262 R856W probably damaging Het
Kcnq3 A T 15: 65,997,773 Y605* probably null Het
Klk1b16 T C 7: 44,141,526 S251P probably benign Het
Map2 A G 1: 66,414,620 N890D probably damaging Het
Map4 T A 9: 110,034,678 S324T probably benign Het
Mmp28 T C 11: 83,442,858 D419G probably damaging Het
Mtnr1b A G 9: 15,862,914 L283P probably benign Het
Ndufb7 T A 8: 83,571,434 Y95N probably damaging Het
Nfrkb C T 9: 31,397,779 R280W probably damaging Het
Npc1l1 A G 11: 6,224,245 Y687H probably damaging Het
Olfr1099 T A 2: 86,958,580 R293* probably null Het
Olfr308 A C 7: 86,321,671 F94V possibly damaging Het
Olfr889 C T 9: 38,116,627 T277I probably benign Het
Olfr919 T C 9: 38,697,647 T240A probably damaging Het
Pabpc4l T C 3: 46,446,609 D200G probably benign Het
Plekhg6 T C 6: 125,372,551 E361G possibly damaging Het
Rictor A G 15: 6,789,565 Y1423C probably damaging Het
Rsf1 G A 7: 97,680,695 D1143N probably damaging Het
Spsb4 C T 9: 96,995,574 probably null Het
Strada G T 11: 106,171,017 A136E probably damaging Het
Syce2 A T 8: 84,883,502 Q73L probably damaging Het
Tex36 A T 7: 133,601,983 N12K probably benign Het
Ubtf A G 11: 102,308,959 S484P probably benign Het
Ufd1 T G 16: 18,817,930 L66R probably damaging Het
Vmn2r74 C T 7: 85,951,989 A814T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Xrcc1 T A 7: 24,567,928 probably null Het
Zfp277 A C 12: 40,335,309 C305G probably damaging Het
Other mutations in Teddm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02098:Teddm2 APN 1 153850335 utr 3 prime probably benign
IGL03218:Teddm2 APN 1 153851024 missense probably benign 0.03
R1464:Teddm2 UTSW 1 153850531 nonsense probably null
R1464:Teddm2 UTSW 1 153850531 nonsense probably null
R1848:Teddm2 UTSW 1 153850448 missense probably benign 0.03
R4732:Teddm2 UTSW 1 153850741 missense probably damaging 1.00
R4733:Teddm2 UTSW 1 153850741 missense probably damaging 1.00
R5595:Teddm2 UTSW 1 153850400 missense probably benign 0.29
R5788:Teddm2 UTSW 1 153851064 missense probably benign 0.01
R6612:Teddm2 UTSW 1 153850445 missense probably benign 0.23
R7034:Teddm2 UTSW 1 153850574 missense probably benign 0.04
R7036:Teddm2 UTSW 1 153850574 missense probably benign 0.04
R7402:Teddm2 UTSW 1 153850597 missense probably damaging 0.99
R7402:Teddm2 UTSW 1 153850598 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAGTCTGCCATCTCAAGCTG -3'
(R):5'- TGGAGACTATAGAGCTGTGGGC -3'

Sequencing Primer
(F):5'- CATCTCAAGCTGGGGCAC -3'
(R):5'- CTGATCTGGATGCTGAAGGCC -3'
Posted On2016-10-24