Incidental Mutation 'R5532:Plekhg6'
ID436214
Institutional Source Beutler Lab
Gene Symbol Plekhg6
Ensembl Gene ENSMUSG00000038167
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 6
SynonymsLOC213522
MMRRC Submission 043090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5532 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125362660-125380793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125372551 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 361 (E361G)
Ref Sequence ENSEMBL: ENSMUSP00000037004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042647]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042647
AA Change: E361G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037004
Gene: ENSMUSG00000038167
AA Change: E361G

DomainStartEndE-ValueType
RhoGEF 165 352 1.5e-44 SMART
PH 410 511 8.99e-7 SMART
low complexity region 535 557 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
A2ml1 T A 6: 128,553,330 probably null Het
Adsl C G 15: 80,963,909 P118A probably damaging Het
Ano6 C T 15: 95,962,241 P748L probably damaging Het
Arhgap10 A T 8: 77,420,072 N234K probably benign Het
Arhgap18 T A 10: 26,846,108 I25K possibly damaging Het
AW551984 T C 9: 39,597,185 Y345C probably damaging Het
Ccdc146 A G 5: 21,305,331 V561A probably benign Het
Cenpv G A 11: 62,527,572 T185M probably damaging Het
Fat2 T A 11: 55,262,337 D3683V probably damaging Het
Galns T C 8: 122,585,026 D415G possibly damaging Het
Gatad2a G A 8: 69,916,420 T259M probably damaging Het
Gja8 T C 3: 96,920,332 S5G probably benign Het
Gm13119 A T 4: 144,363,491 D367V probably damaging Het
Gm4951 A G 18: 60,246,070 I226V probably benign Het
Ifi209 T C 1: 173,638,976 S125P probably damaging Het
Il12rb2 G A 6: 67,292,262 R856W probably damaging Het
Kcnq3 A T 15: 65,997,773 Y605* probably null Het
Klk1b16 T C 7: 44,141,526 S251P probably benign Het
Map2 A G 1: 66,414,620 N890D probably damaging Het
Map4 T A 9: 110,034,678 S324T probably benign Het
Mmp28 T C 11: 83,442,858 D419G probably damaging Het
Mtnr1b A G 9: 15,862,914 L283P probably benign Het
Ndufb7 T A 8: 83,571,434 Y95N probably damaging Het
Nfrkb C T 9: 31,397,779 R280W probably damaging Het
Npc1l1 A G 11: 6,224,245 Y687H probably damaging Het
Olfr1099 T A 2: 86,958,580 R293* probably null Het
Olfr308 A C 7: 86,321,671 F94V possibly damaging Het
Olfr889 C T 9: 38,116,627 T277I probably benign Het
Olfr919 T C 9: 38,697,647 T240A probably damaging Het
Pabpc4l T C 3: 46,446,609 D200G probably benign Het
Rictor A G 15: 6,789,565 Y1423C probably damaging Het
Rsf1 G A 7: 97,680,695 D1143N probably damaging Het
Spsb4 C T 9: 96,995,574 probably null Het
Strada G T 11: 106,171,017 A136E probably damaging Het
Syce2 A T 8: 84,883,502 Q73L probably damaging Het
Teddm2 A T 1: 153,850,384 V195D probably benign Het
Tex36 A T 7: 133,601,983 N12K probably benign Het
Ubtf A G 11: 102,308,959 S484P probably benign Het
Ufd1 T G 16: 18,817,930 L66R probably damaging Het
Vmn2r74 C T 7: 85,951,989 A814T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Xrcc1 T A 7: 24,567,928 probably null Het
Zfp277 A C 12: 40,335,309 C305G probably damaging Het
Other mutations in Plekhg6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Plekhg6 APN 6 125372551 missense probably null 0.89
IGL01466:Plekhg6 APN 6 125372624 splice site probably benign
IGL01621:Plekhg6 APN 6 125372099 missense probably damaging 1.00
IGL01679:Plekhg6 APN 6 125374979 missense probably benign 0.45
IGL01696:Plekhg6 APN 6 125378830 missense probably benign 0.00
IGL02600:Plekhg6 APN 6 125370600 nonsense probably null
IGL02604:Plekhg6 APN 6 125377379 splice site probably benign
IGL02668:Plekhg6 APN 6 125372803 splice site probably benign
R0370:Plekhg6 UTSW 6 125370660 missense probably damaging 1.00
R0426:Plekhg6 UTSW 6 125364629 unclassified probably null
R1182:Plekhg6 UTSW 6 125372492 missense probably damaging 0.99
R1401:Plekhg6 UTSW 6 125363109 missense probably damaging 1.00
R1855:Plekhg6 UTSW 6 125375839 missense probably damaging 1.00
R1888:Plekhg6 UTSW 6 125363343 missense probably damaging 1.00
R1888:Plekhg6 UTSW 6 125363343 missense probably damaging 1.00
R2264:Plekhg6 UTSW 6 125377468 missense probably benign 0.00
R2991:Plekhg6 UTSW 6 125370469 missense probably damaging 0.99
R3980:Plekhg6 UTSW 6 125373183 missense probably damaging 1.00
R4193:Plekhg6 UTSW 6 125373118 missense probably benign 0.01
R4227:Plekhg6 UTSW 6 125378805 missense probably damaging 0.99
R4689:Plekhg6 UTSW 6 125373181 missense probably benign 0.43
R5573:Plekhg6 UTSW 6 125375792 missense possibly damaging 0.56
R6803:Plekhg6 UTSW 6 125363663 missense probably damaging 0.98
R6885:Plekhg6 UTSW 6 125378730 missense probably benign
R7105:Plekhg6 UTSW 6 125378805 missense probably damaging 0.99
R7599:Plekhg6 UTSW 6 125374660 missense probably damaging 0.99
R7626:Plekhg6 UTSW 6 125363668 missense probably benign 0.08
R8069:Plekhg6 UTSW 6 125363046 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTTTGGGTTCCTCTCACAGG -3'
(R):5'- TGATCTCTAGTGTTCCCCGAAG -3'

Sequencing Primer
(F):5'- ATGGACACACCCAGCTGTG -3'
(R):5'- GAAGGTCTCGTTCCCCCTACAG -3'
Posted On2016-10-24