Incidental Mutation 'R5532:Xrcc1'
ID436216
Institutional Source Beutler Lab
Gene Symbol Xrcc1
Ensembl Gene ENSMUSG00000051768
Gene NameX-ray repair complementing defective repair in Chinese hamster cells 1
SynonymsXrcc-1
MMRRC Submission 043090-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5532 (G1)
Quality Score163
Status Not validated
Chromosome7
Chromosomal Location24546289-24573440 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 24567928 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063249] [ENSMUST00000205573]
Predicted Effect probably null
Transcript: ENSMUST00000063249
SMART Domains Protein: ENSMUSP00000070995
Gene: ENSMUSG00000051768

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 151 6.9e-66 PFAM
low complexity region 212 238 N/A INTRINSIC
low complexity region 278 294 N/A INTRINSIC
BRCT 317 393 8e-19 SMART
low complexity region 407 424 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
BRCT 538 617 5.5e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205564
Predicted Effect probably null
Transcript: ENSMUST00000205573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206538
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the efficient repair of DNA single-strand breaks formed by exposure to ionizing radiation and alkylating agents. This protein interacts with DNA ligase III, polymerase beta and poly (ADP-ribose) polymerase to participate in the base excision repair pathway. It may play a role in DNA processing during meiogenesis and recombination in germ cells. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants accumulate unrepaired DNA strand breaks in the egg cylinder, show increased cell death in epiblast, developmental arrest at embryonic day 6.5, morphological anomalies in visceral embryonic endoderm by day 7.5 and die by day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
A2ml1 T A 6: 128,553,330 probably null Het
Adsl C G 15: 80,963,909 P118A probably damaging Het
Ano6 C T 15: 95,962,241 P748L probably damaging Het
Arhgap10 A T 8: 77,420,072 N234K probably benign Het
Arhgap18 T A 10: 26,846,108 I25K possibly damaging Het
AW551984 T C 9: 39,597,185 Y345C probably damaging Het
Ccdc146 A G 5: 21,305,331 V561A probably benign Het
Cenpv G A 11: 62,527,572 T185M probably damaging Het
Fat2 T A 11: 55,262,337 D3683V probably damaging Het
Galns T C 8: 122,585,026 D415G possibly damaging Het
Gatad2a G A 8: 69,916,420 T259M probably damaging Het
Gja8 T C 3: 96,920,332 S5G probably benign Het
Gm13119 A T 4: 144,363,491 D367V probably damaging Het
Gm4951 A G 18: 60,246,070 I226V probably benign Het
Ifi209 T C 1: 173,638,976 S125P probably damaging Het
Il12rb2 G A 6: 67,292,262 R856W probably damaging Het
Kcnq3 A T 15: 65,997,773 Y605* probably null Het
Klk1b16 T C 7: 44,141,526 S251P probably benign Het
Map2 A G 1: 66,414,620 N890D probably damaging Het
Map4 T A 9: 110,034,678 S324T probably benign Het
Mmp28 T C 11: 83,442,858 D419G probably damaging Het
Mtnr1b A G 9: 15,862,914 L283P probably benign Het
Ndufb7 T A 8: 83,571,434 Y95N probably damaging Het
Nfrkb C T 9: 31,397,779 R280W probably damaging Het
Npc1l1 A G 11: 6,224,245 Y687H probably damaging Het
Olfr1099 T A 2: 86,958,580 R293* probably null Het
Olfr308 A C 7: 86,321,671 F94V possibly damaging Het
Olfr889 C T 9: 38,116,627 T277I probably benign Het
Olfr919 T C 9: 38,697,647 T240A probably damaging Het
Pabpc4l T C 3: 46,446,609 D200G probably benign Het
Plekhg6 T C 6: 125,372,551 E361G possibly damaging Het
Rictor A G 15: 6,789,565 Y1423C probably damaging Het
Rsf1 G A 7: 97,680,695 D1143N probably damaging Het
Spsb4 C T 9: 96,995,574 probably null Het
Strada G T 11: 106,171,017 A136E probably damaging Het
Syce2 A T 8: 84,883,502 Q73L probably damaging Het
Teddm2 A T 1: 153,850,384 V195D probably benign Het
Tex36 A T 7: 133,601,983 N12K probably benign Het
Ubtf A G 11: 102,308,959 S484P probably benign Het
Ufd1 T G 16: 18,817,930 L66R probably damaging Het
Vmn2r74 C T 7: 85,951,989 A814T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Zfp277 A C 12: 40,335,309 C305G probably damaging Het
Other mutations in Xrcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Xrcc1 APN 7 24547884 critical splice donor site probably null
IGL01830:Xrcc1 APN 7 24573342 utr 3 prime probably benign
IGL02349:Xrcc1 APN 7 24567042 nonsense probably null
IGL02433:Xrcc1 APN 7 24565554 missense possibly damaging 0.96
IGL03131:Xrcc1 APN 7 24573294 nonsense probably null
bilberry UTSW 7 24570218 missense probably damaging 1.00
R0090:Xrcc1 UTSW 7 24570217 missense probably damaging 0.99
R0517:Xrcc1 UTSW 7 24570319 splice site probably benign
R0612:Xrcc1 UTSW 7 24570319 splice site probably benign
R1234:Xrcc1 UTSW 7 24567845 missense possibly damaging 0.71
R1577:Xrcc1 UTSW 7 24565627 nonsense probably null
R1796:Xrcc1 UTSW 7 24547827 missense probably damaging 1.00
R1863:Xrcc1 UTSW 7 24570575 missense possibly damaging 0.65
R3788:Xrcc1 UTSW 7 24566908 missense probably benign 0.08
R3794:Xrcc1 UTSW 7 24570560 missense probably benign 0.05
R4806:Xrcc1 UTSW 7 24570480 missense probably benign 0.14
R5206:Xrcc1 UTSW 7 24567563 missense probably damaging 1.00
R5414:Xrcc1 UTSW 7 24570218 missense probably damaging 1.00
R5624:Xrcc1 UTSW 7 24559845 missense possibly damaging 0.57
R5990:Xrcc1 UTSW 7 24567868 missense probably damaging 1.00
R6603:Xrcc1 UTSW 7 24571034 nonsense probably null
R6669:Xrcc1 UTSW 7 24547337 missense probably damaging 1.00
R6716:Xrcc1 UTSW 7 24567146 critical splice donor site probably null
R6881:Xrcc1 UTSW 7 24547351 nonsense probably null
R7227:Xrcc1 UTSW 7 24547332 missense probably damaging 1.00
X0019:Xrcc1 UTSW 7 24573128 missense probably damaging 1.00
X0024:Xrcc1 UTSW 7 24573079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTCAGCTGTCCATCAGATC -3'
(R):5'- GTTCTGAGGAATGGCATACAGC -3'

Sequencing Primer
(F):5'- AGCTGTCCATCAGATCATGTC -3'
(R):5'- GCCGTCATTACAAAATCCAGTGG -3'
Posted On2016-10-24