Incidental Mutation 'R5532:Klk1b16'
ID436217
Institutional Source Beutler Lab
Gene Symbol Klk1b16
Ensembl Gene ENSMUSG00000038968
Gene Namekallikrein 1-related peptidase b16
SynonymsKlk16, mGk-16
MMRRC Submission 043090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5532 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44136767-44141610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44141526 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 251 (S251P)
Ref Sequence ENSEMBL: ENSMUSP00000005933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005933]
Predicted Effect probably benign
Transcript: ENSMUST00000005933
AA Change: S251P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000005933
Gene: ENSMUSG00000038968
AA Change: S251P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 7.64e-80 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
A2ml1 T A 6: 128,553,330 probably null Het
Adsl C G 15: 80,963,909 P118A probably damaging Het
Ano6 C T 15: 95,962,241 P748L probably damaging Het
Arhgap10 A T 8: 77,420,072 N234K probably benign Het
Arhgap18 T A 10: 26,846,108 I25K possibly damaging Het
AW551984 T C 9: 39,597,185 Y345C probably damaging Het
Ccdc146 A G 5: 21,305,331 V561A probably benign Het
Cenpv G A 11: 62,527,572 T185M probably damaging Het
Fat2 T A 11: 55,262,337 D3683V probably damaging Het
Galns T C 8: 122,585,026 D415G possibly damaging Het
Gatad2a G A 8: 69,916,420 T259M probably damaging Het
Gja8 T C 3: 96,920,332 S5G probably benign Het
Gm13119 A T 4: 144,363,491 D367V probably damaging Het
Gm4951 A G 18: 60,246,070 I226V probably benign Het
Ifi209 T C 1: 173,638,976 S125P probably damaging Het
Il12rb2 G A 6: 67,292,262 R856W probably damaging Het
Kcnq3 A T 15: 65,997,773 Y605* probably null Het
Map2 A G 1: 66,414,620 N890D probably damaging Het
Map4 T A 9: 110,034,678 S324T probably benign Het
Mmp28 T C 11: 83,442,858 D419G probably damaging Het
Mtnr1b A G 9: 15,862,914 L283P probably benign Het
Ndufb7 T A 8: 83,571,434 Y95N probably damaging Het
Nfrkb C T 9: 31,397,779 R280W probably damaging Het
Npc1l1 A G 11: 6,224,245 Y687H probably damaging Het
Olfr1099 T A 2: 86,958,580 R293* probably null Het
Olfr308 A C 7: 86,321,671 F94V possibly damaging Het
Olfr889 C T 9: 38,116,627 T277I probably benign Het
Olfr919 T C 9: 38,697,647 T240A probably damaging Het
Pabpc4l T C 3: 46,446,609 D200G probably benign Het
Plekhg6 T C 6: 125,372,551 E361G possibly damaging Het
Rictor A G 15: 6,789,565 Y1423C probably damaging Het
Rsf1 G A 7: 97,680,695 D1143N probably damaging Het
Spsb4 C T 9: 96,995,574 probably null Het
Strada G T 11: 106,171,017 A136E probably damaging Het
Syce2 A T 8: 84,883,502 Q73L probably damaging Het
Teddm2 A T 1: 153,850,384 V195D probably benign Het
Tex36 A T 7: 133,601,983 N12K probably benign Het
Ubtf A G 11: 102,308,959 S484P probably benign Het
Ufd1 T G 16: 18,817,930 L66R probably damaging Het
Vmn2r74 C T 7: 85,951,989 A814T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Xrcc1 T A 7: 24,567,928 probably null Het
Zfp277 A C 12: 40,335,309 C305G probably damaging Het
Other mutations in Klk1b16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Klk1b16 APN 7 44140678 missense probably damaging 0.98
IGL01529:Klk1b16 APN 7 44140739 missense probably benign 0.18
R1105:Klk1b16 UTSW 7 44139513 missense probably damaging 0.98
R1106:Klk1b16 UTSW 7 44139513 missense probably damaging 0.98
R1559:Klk1b16 UTSW 7 44141001 missense probably benign 0.00
R3883:Klk1b16 UTSW 7 44139463 missense possibly damaging 0.86
R3884:Klk1b16 UTSW 7 44139463 missense possibly damaging 0.86
R4152:Klk1b16 UTSW 7 44140549 missense probably benign 0.09
R4398:Klk1b16 UTSW 7 44141427 missense probably damaging 1.00
R5231:Klk1b16 UTSW 7 44137347 missense probably damaging 1.00
R5389:Klk1b16 UTSW 7 44140988 missense possibly damaging 0.83
R5470:Klk1b16 UTSW 7 44137331 missense probably damaging 0.99
R5690:Klk1b16 UTSW 7 44140894 critical splice acceptor site probably null
R5717:Klk1b16 UTSW 7 44139489 missense probably benign 0.00
R5749:Klk1b16 UTSW 7 44140786 missense probably benign 0.03
R6589:Klk1b16 UTSW 7 44141470 missense probably benign 0.03
R7084:Klk1b16 UTSW 7 44139486 missense probably benign 0.01
R7336:Klk1b16 UTSW 7 44141483 missense probably benign 0.05
X0026:Klk1b16 UTSW 7 44140944 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGAATCCAACTGCCAGGC -3'
(R):5'- GCATTTGTCTCAACCCCATG -3'

Sequencing Primer
(F):5'- CAACTGCCAGGCCCTGC -3'
(R):5'- GCCAACAATACATGTACTCCTGTC -3'
Posted On2016-10-24