Incidental Mutation 'R5532:Olfr308'
ID436219
Institutional Source Beutler Lab
Gene Symbol Olfr308
Ensembl Gene ENSMUSG00000054498
Gene Nameolfactory receptor 308
SynonymsMOR104-1, GA_x6K02T2NHDJ-9786435-9787361
MMRRC Submission 043090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5532 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86318218-86325630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86321671 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 94 (F94V)
Ref Sequence ENSEMBL: ENSMUSP00000150391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044256] [ENSMUST00000214977]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044256
AA Change: F94V

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049454
Gene: ENSMUSG00000054498
AA Change: F94V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.3e-53 PFAM
Pfam:7tm_1 41 290 2.2e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214977
AA Change: F94V

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215841
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
A2ml1 T A 6: 128,553,330 probably null Het
Adsl C G 15: 80,963,909 P118A probably damaging Het
Ano6 C T 15: 95,962,241 P748L probably damaging Het
Arhgap10 A T 8: 77,420,072 N234K probably benign Het
Arhgap18 T A 10: 26,846,108 I25K possibly damaging Het
AW551984 T C 9: 39,597,185 Y345C probably damaging Het
Ccdc146 A G 5: 21,305,331 V561A probably benign Het
Cenpv G A 11: 62,527,572 T185M probably damaging Het
Fat2 T A 11: 55,262,337 D3683V probably damaging Het
Galns T C 8: 122,585,026 D415G possibly damaging Het
Gatad2a G A 8: 69,916,420 T259M probably damaging Het
Gja8 T C 3: 96,920,332 S5G probably benign Het
Gm13119 A T 4: 144,363,491 D367V probably damaging Het
Gm4951 A G 18: 60,246,070 I226V probably benign Het
Ifi209 T C 1: 173,638,976 S125P probably damaging Het
Il12rb2 G A 6: 67,292,262 R856W probably damaging Het
Kcnq3 A T 15: 65,997,773 Y605* probably null Het
Klk1b16 T C 7: 44,141,526 S251P probably benign Het
Map2 A G 1: 66,414,620 N890D probably damaging Het
Map4 T A 9: 110,034,678 S324T probably benign Het
Mmp28 T C 11: 83,442,858 D419G probably damaging Het
Mtnr1b A G 9: 15,862,914 L283P probably benign Het
Ndufb7 T A 8: 83,571,434 Y95N probably damaging Het
Nfrkb C T 9: 31,397,779 R280W probably damaging Het
Npc1l1 A G 11: 6,224,245 Y687H probably damaging Het
Olfr1099 T A 2: 86,958,580 R293* probably null Het
Olfr889 C T 9: 38,116,627 T277I probably benign Het
Olfr919 T C 9: 38,697,647 T240A probably damaging Het
Pabpc4l T C 3: 46,446,609 D200G probably benign Het
Plekhg6 T C 6: 125,372,551 E361G possibly damaging Het
Rictor A G 15: 6,789,565 Y1423C probably damaging Het
Rsf1 G A 7: 97,680,695 D1143N probably damaging Het
Spsb4 C T 9: 96,995,574 probably null Het
Strada G T 11: 106,171,017 A136E probably damaging Het
Syce2 A T 8: 84,883,502 Q73L probably damaging Het
Teddm2 A T 1: 153,850,384 V195D probably benign Het
Tex36 A T 7: 133,601,983 N12K probably benign Het
Ubtf A G 11: 102,308,959 S484P probably benign Het
Ufd1 T G 16: 18,817,930 L66R probably damaging Het
Vmn2r74 C T 7: 85,951,989 A814T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Xrcc1 T A 7: 24,567,928 probably null Het
Zfp277 A C 12: 40,335,309 C305G probably damaging Het
Other mutations in Olfr308
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Olfr308 APN 7 86321153 missense probably benign
IGL03141:Olfr308 APN 7 86321701 missense probably damaging 0.97
PIT4519001:Olfr308 UTSW 7 86321733 missense probably damaging 1.00
R0206:Olfr308 UTSW 7 86321646 missense probably benign 0.22
R0206:Olfr308 UTSW 7 86321646 missense probably benign 0.22
R0401:Olfr308 UTSW 7 86321292 missense probably benign 0.02
R2132:Olfr308 UTSW 7 86321479 missense possibly damaging 0.94
R3983:Olfr308 UTSW 7 86321734 missense probably damaging 1.00
R4596:Olfr308 UTSW 7 86321423 missense probably damaging 1.00
R7326:Olfr308 UTSW 7 86321574 missense probably damaging 0.99
R7480:Olfr308 UTSW 7 86321680 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AAGGTGCTGATGAGTGCTGC -3'
(R):5'- GTGATGTACCTCCTCACCATTGG -3'

Sequencing Primer
(F):5'- TGGCACAGAAATGGCCAG -3'
(R):5'- CCATTGGTGGTAATATGGCAATC -3'
Posted On2016-10-24