Incidental Mutation 'R0006:Aurka'
ID43622
Institutional Source Beutler Lab
Gene Symbol Aurka
Ensembl Gene ENSMUSG00000027496
Gene Nameaurora kinase A
SynonymsIAK, IAK1, Aurora-A, aurora A, Ark1, Ayk1, AIRK1, Stk6
MMRRC Submission 041980-MU
Accession Numbers

Ncbi RefSeq: NM_011497.3; MGI:894678

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0006 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location172356190-172370535 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 172359753 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028995] [ENSMUST00000028997] [ENSMUST00000109139] [ENSMUST00000109140]
Predicted Effect probably benign
Transcript: ENSMUST00000028995
SMART Domains Protein: ENSMUSP00000028995
Gene: ENSMUSG00000027495

DomainStartEndE-ValueType
Pfam:DUF1279 85 172 4e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000028997
SMART Domains Protein: ENSMUSP00000028997
Gene: ENSMUSG00000027496

DomainStartEndE-ValueType
S_TKc 146 396 2.25e-99 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109139
SMART Domains Protein: ENSMUSP00000104767
Gene: ENSMUSG00000027496

DomainStartEndE-ValueType
S_TKc 124 374 2.25e-99 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109140
SMART Domains Protein: ENSMUSP00000104768
Gene: ENSMUSG00000027496

DomainStartEndE-ValueType
S_TKc 124 374 2.25e-99 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128004
Meta Mutation Damage Score 0.9500 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype Strain: 3836423; 3826513
Lethality: E1-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell cycle-regulated kinase that appears to be involved in microtubule formation and/or stabilization at the spindle pole during chromosome segregation. The encoded protein is found at the centrosome in interphase cells and at the spindle poles in mitosis. This gene may play a role in tumor development and progression. A processed pseudogene of this gene has been found on chromosome 1, and an unprocessed pseudogene has been found on chromosome 10. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before implantation, early embryonic growth arrest, and impaired mitosis. Heterozygous null mice display increased incidence of tumors primarily lymphomas and chromosomal instability. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(4) Gene trapped(21)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Aurka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Aurka APN 2 172368979 unclassified probably benign
IGL02338:Aurka APN 2 172359858 missense probably benign 0.00
IGL02894:Aurka APN 2 172366948 unclassified probably null
IGL03188:Aurka APN 2 172363768 missense possibly damaging 0.60
PIT4585001:Aurka UTSW 2 172357197 missense probably benign 0.01
R0006:Aurka UTSW 2 172359753 critical splice donor site probably null
R0458:Aurka UTSW 2 172370446 nonsense probably null
R0555:Aurka UTSW 2 172367147 missense probably benign 0.07
R1130:Aurka UTSW 2 172357258 splice site probably null
R1140:Aurka UTSW 2 172357229 missense probably damaging 1.00
R2507:Aurka UTSW 2 172370445 missense probably benign 0.00
R2887:Aurka UTSW 2 172367120 missense probably benign 0.01
R2889:Aurka UTSW 2 172367120 missense probably benign 0.01
R3772:Aurka UTSW 2 172366960 missense probably benign
R4929:Aurka UTSW 2 172370406 missense probably benign 0.05
R5409:Aurka UTSW 2 172367116 missense possibly damaging 0.78
R6158:Aurka UTSW 2 172363596 critical splice donor site probably null
R6689:Aurka UTSW 2 172370393 critical splice donor site probably null
R6828:Aurka UTSW 2 172357252 missense probably damaging 1.00
R7912:Aurka UTSW 2 172369029 missense probably benign 0.00
R7993:Aurka UTSW 2 172369029 missense probably benign 0.00
R8066:Aurka UTSW 2 172370418 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTACAAGTCTCTCCAGGACACAC -3'
(R):5'- GGTCAACTTGCAGTTTTGCCTGATG -3'

Sequencing Primer
(F):5'- GGACACACCTTTGTTTACCAAC -3'
(R):5'- TGCCTGATGGCCTTACATATAAACC -3'
Posted On2013-05-29