Incidental Mutation 'R5532:Gatad2a'
ID436222
Institutional Source Beutler Lab
Gene Symbol Gatad2a
Ensembl Gene ENSMUSG00000036180
Gene NameGATA zinc finger domain containing 2A
Synonyms
MMRRC Submission 043090-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5532 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location69907076-69996384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69916420 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 259 (T259M)
Ref Sequence ENSEMBL: ENSMUSP00000070229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065169] [ENSMUST00000116463] [ENSMUST00000177851] [ENSMUST00000211960] [ENSMUST00000212277] [ENSMUST00000212478]
Predicted Effect probably damaging
Transcript: ENSMUST00000065169
AA Change: T259M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070229
Gene: ENSMUSG00000036180
AA Change: T259M

DomainStartEndE-ValueType
low complexity region 66 77 N/A INTRINSIC
Pfam:P66_CC 132 175 8.1e-24 PFAM
low complexity region 276 289 N/A INTRINSIC
low complexity region 322 339 N/A INTRINSIC
low complexity region 340 352 N/A INTRINSIC
low complexity region 360 367 N/A INTRINSIC
low complexity region 465 478 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116463
AA Change: T258M

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112164
Gene: ENSMUSG00000036180
AA Change: T258M

DomainStartEndE-ValueType
low complexity region 66 77 N/A INTRINSIC
coiled coil region 135 169 N/A INTRINSIC
low complexity region 275 288 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
low complexity region 359 366 N/A INTRINSIC
low complexity region 464 477 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177851
AA Change: T261M

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137386
Gene: ENSMUSG00000036180
AA Change: T261M

DomainStartEndE-ValueType
low complexity region 66 77 N/A INTRINSIC
coiled coil region 135 169 N/A INTRINSIC
low complexity region 275 288 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
low complexity region 359 366 N/A INTRINSIC
low complexity region 464 477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211960
Predicted Effect probably benign
Transcript: ENSMUST00000212277
Predicted Effect probably damaging
Transcript: ENSMUST00000212478
AA Change: T258M

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die around E9.5 displaying variable developmental defects, including malformed or unfused neural folds, failure of closure of anterior neuropore, missing or excessively large blood vessels in the yolk sac, abnormal embryo turning, and embryonic growth arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
A2ml1 T A 6: 128,553,330 probably null Het
Adsl C G 15: 80,963,909 P118A probably damaging Het
Ano6 C T 15: 95,962,241 P748L probably damaging Het
Arhgap10 A T 8: 77,420,072 N234K probably benign Het
Arhgap18 T A 10: 26,846,108 I25K possibly damaging Het
AW551984 T C 9: 39,597,185 Y345C probably damaging Het
Ccdc146 A G 5: 21,305,331 V561A probably benign Het
Cenpv G A 11: 62,527,572 T185M probably damaging Het
Fat2 T A 11: 55,262,337 D3683V probably damaging Het
Galns T C 8: 122,585,026 D415G possibly damaging Het
Gja8 T C 3: 96,920,332 S5G probably benign Het
Gm13119 A T 4: 144,363,491 D367V probably damaging Het
Gm4951 A G 18: 60,246,070 I226V probably benign Het
Ifi209 T C 1: 173,638,976 S125P probably damaging Het
Il12rb2 G A 6: 67,292,262 R856W probably damaging Het
Kcnq3 A T 15: 65,997,773 Y605* probably null Het
Klk1b16 T C 7: 44,141,526 S251P probably benign Het
Map2 A G 1: 66,414,620 N890D probably damaging Het
Map4 T A 9: 110,034,678 S324T probably benign Het
Mmp28 T C 11: 83,442,858 D419G probably damaging Het
Mtnr1b A G 9: 15,862,914 L283P probably benign Het
Ndufb7 T A 8: 83,571,434 Y95N probably damaging Het
Nfrkb C T 9: 31,397,779 R280W probably damaging Het
Npc1l1 A G 11: 6,224,245 Y687H probably damaging Het
Olfr1099 T A 2: 86,958,580 R293* probably null Het
Olfr308 A C 7: 86,321,671 F94V possibly damaging Het
Olfr889 C T 9: 38,116,627 T277I probably benign Het
Olfr919 T C 9: 38,697,647 T240A probably damaging Het
Pabpc4l T C 3: 46,446,609 D200G probably benign Het
Plekhg6 T C 6: 125,372,551 E361G possibly damaging Het
Rictor A G 15: 6,789,565 Y1423C probably damaging Het
Rsf1 G A 7: 97,680,695 D1143N probably damaging Het
Spsb4 C T 9: 96,995,574 probably null Het
Strada G T 11: 106,171,017 A136E probably damaging Het
Syce2 A T 8: 84,883,502 Q73L probably damaging Het
Teddm2 A T 1: 153,850,384 V195D probably benign Het
Tex36 A T 7: 133,601,983 N12K probably benign Het
Ubtf A G 11: 102,308,959 S484P probably benign Het
Ufd1 T G 16: 18,817,930 L66R probably damaging Het
Vmn2r74 C T 7: 85,951,989 A814T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Xrcc1 T A 7: 24,567,928 probably null Het
Zfp277 A C 12: 40,335,309 C305G probably damaging Het
Other mutations in Gatad2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Gatad2a APN 8 69909948 missense possibly damaging 0.94
R1730:Gatad2a UTSW 8 69909936 missense probably damaging 1.00
R1783:Gatad2a UTSW 8 69909936 missense probably damaging 1.00
R1894:Gatad2a UTSW 8 69916651 missense probably damaging 1.00
R1982:Gatad2a UTSW 8 69913132 nonsense probably null
R3762:Gatad2a UTSW 8 69916280 splice site probably null
R5241:Gatad2a UTSW 8 69918017 nonsense probably null
R5526:Gatad2a UTSW 8 69935941 missense probably damaging 1.00
R6664:Gatad2a UTSW 8 69917489 missense probably damaging 1.00
R7036:Gatad2a UTSW 8 69917994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAATGGTACTATGAGACCTACC -3'
(R):5'- AGGCCAGCTCTCAAGTAGTC -3'

Sequencing Primer
(F):5'- TGGTACTATGAGACCTACCAGGAC -3'
(R):5'- AAGTAGTCATGCCACCGCTTG -3'
Posted On2016-10-24