Incidental Mutation 'R5532:Galns'
ID436224
Institutional Source Beutler Lab
Gene Symbol Galns
Ensembl Gene ENSMUSG00000015027
Gene Namegalactosamine (N-acetyl)-6-sulfate sulfatase
SynonymsN-acetylgalactosamine-6-sulfate sulfatase
MMRRC Submission 043090-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5532 (G1)
Quality Score180
Status Not validated
Chromosome8
Chromosomal Location122578242-122611463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122585026 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 415 (D415G)
Ref Sequence ENSEMBL: ENSMUSP00000015171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015171] [ENSMUST00000127664] [ENSMUST00000212319]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015171
AA Change: D415G

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000015171
Gene: ENSMUSG00000015027
AA Change: D415G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 28 353 2.3e-91 PFAM
Pfam:Phosphodiest 30 315 2.1e-11 PFAM
Pfam:Sulfatase_C 376 507 2.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211906
Predicted Effect probably benign
Transcript: ENSMUST00000212319
AA Change: D335G

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes N-acetylgalactosamine-6-sulfatase which is a lysosomal exohydrolase required for the degradation of the glycosaminoglycans, keratan sulfate, and chondroitin 6-sulfate. Sequence alterations including point, missense and nonsense mutations, as well as those that affect splicing, result in a deficiency of this enzyme. Deficiencies of this enzyme lead to Morquio A syndrome, a lysosomal storage disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable, fertile, and healthy in spite of lysosmal storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
A2ml1 T A 6: 128,553,330 probably null Het
Adsl C G 15: 80,963,909 P118A probably damaging Het
Ano6 C T 15: 95,962,241 P748L probably damaging Het
Arhgap10 A T 8: 77,420,072 N234K probably benign Het
Arhgap18 T A 10: 26,846,108 I25K possibly damaging Het
AW551984 T C 9: 39,597,185 Y345C probably damaging Het
Ccdc146 A G 5: 21,305,331 V561A probably benign Het
Cenpv G A 11: 62,527,572 T185M probably damaging Het
Fat2 T A 11: 55,262,337 D3683V probably damaging Het
Gatad2a G A 8: 69,916,420 T259M probably damaging Het
Gja8 T C 3: 96,920,332 S5G probably benign Het
Gm13119 A T 4: 144,363,491 D367V probably damaging Het
Gm4951 A G 18: 60,246,070 I226V probably benign Het
Ifi209 T C 1: 173,638,976 S125P probably damaging Het
Il12rb2 G A 6: 67,292,262 R856W probably damaging Het
Kcnq3 A T 15: 65,997,773 Y605* probably null Het
Klk1b16 T C 7: 44,141,526 S251P probably benign Het
Map2 A G 1: 66,414,620 N890D probably damaging Het
Map4 T A 9: 110,034,678 S324T probably benign Het
Mmp28 T C 11: 83,442,858 D419G probably damaging Het
Mtnr1b A G 9: 15,862,914 L283P probably benign Het
Ndufb7 T A 8: 83,571,434 Y95N probably damaging Het
Nfrkb C T 9: 31,397,779 R280W probably damaging Het
Npc1l1 A G 11: 6,224,245 Y687H probably damaging Het
Olfr1099 T A 2: 86,958,580 R293* probably null Het
Olfr308 A C 7: 86,321,671 F94V possibly damaging Het
Olfr889 C T 9: 38,116,627 T277I probably benign Het
Olfr919 T C 9: 38,697,647 T240A probably damaging Het
Pabpc4l T C 3: 46,446,609 D200G probably benign Het
Plekhg6 T C 6: 125,372,551 E361G possibly damaging Het
Rictor A G 15: 6,789,565 Y1423C probably damaging Het
Rsf1 G A 7: 97,680,695 D1143N probably damaging Het
Spsb4 C T 9: 96,995,574 probably null Het
Strada G T 11: 106,171,017 A136E probably damaging Het
Syce2 A T 8: 84,883,502 Q73L probably damaging Het
Teddm2 A T 1: 153,850,384 V195D probably benign Het
Tex36 A T 7: 133,601,983 N12K probably benign Het
Ubtf A G 11: 102,308,959 S484P probably benign Het
Ufd1 T G 16: 18,817,930 L66R probably damaging Het
Vmn2r74 C T 7: 85,951,989 A814T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Xrcc1 T A 7: 24,567,928 probably null Het
Zfp277 A C 12: 40,335,309 C305G probably damaging Het
Other mutations in Galns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Galns APN 8 122598626 missense probably damaging 1.00
IGL02401:Galns APN 8 122605199 missense probably damaging 1.00
brimstone UTSW 8 122600610 missense probably damaging 1.00
fiend UTSW 8 122611338 start codon destroyed probably null
vesuvius UTSW 8 122599348 splice site probably null
R0001:Galns UTSW 8 122595883 splice site probably benign
R0018:Galns UTSW 8 122584985 missense probably benign 0.09
R1417:Galns UTSW 8 122584913 missense possibly damaging 0.71
R1636:Galns UTSW 8 122604216 splice site probably benign
R4729:Galns UTSW 8 122603456 missense probably damaging 1.00
R4851:Galns UTSW 8 122600533 missense probably damaging 1.00
R4891:Galns UTSW 8 122599156 missense possibly damaging 0.92
R5218:Galns UTSW 8 122598589 missense probably damaging 0.99
R6323:Galns UTSW 8 122598651 missense probably damaging 1.00
R6444:Galns UTSW 8 122611338 start codon destroyed probably null
R6495:Galns UTSW 8 122600610 missense probably damaging 1.00
R7215:Galns UTSW 8 122599348 splice site probably null
R7608:Galns UTSW 8 122591445 missense probably benign 0.06
R7612:Galns UTSW 8 122584954 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AGACGTGGTTCTCACCTTTG -3'
(R):5'- CCCAGAGACAGATGCTAAGCAG -3'

Sequencing Primer
(F):5'- GTGGTTCTCACCTTTGGCCTG -3'
(R):5'- GATGCTAAGCAGTTCCTCCTGAAG -3'
Posted On2016-10-24