Incidental Mutation 'R5532:Nfrkb'
ID436226
Institutional Source Beutler Lab
Gene Symbol Nfrkb
Ensembl Gene ENSMUSG00000042185
Gene Namenuclear factor related to kappa B binding protein
SynonymsA530090G11Rik
MMRRC Submission 043090-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.638) question?
Stock #R5532 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location31386192-31421333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31397779 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 280 (R280W)
Ref Sequence ENSEMBL: ENSMUSP00000149841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086167] [ENSMUST00000131540] [ENSMUST00000132329] [ENSMUST00000152593] [ENSMUST00000215211]
Predicted Effect probably damaging
Transcript: ENSMUST00000086167
AA Change: R268W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083341
Gene: ENSMUSG00000042185
AA Change: R268W

DomainStartEndE-ValueType
low complexity region 209 234 N/A INTRINSIC
coiled coil region 304 335 N/A INTRINSIC
Pfam:NFRKB_winged 379 478 4.5e-35 PFAM
low complexity region 663 690 N/A INTRINSIC
low complexity region 700 740 N/A INTRINSIC
internal_repeat_1 879 953 2.02e-5 PROSPERO
low complexity region 1016 1034 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
internal_repeat_1 1128 1201 2.02e-5 PROSPERO
low complexity region 1239 1255 N/A INTRINSIC
low complexity region 1269 1290 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128375
Predicted Effect probably benign
Transcript: ENSMUST00000131540
Predicted Effect probably benign
Transcript: ENSMUST00000132329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150179
Predicted Effect probably benign
Transcript: ENSMUST00000152593
SMART Domains Protein: ENSMUSP00000119025
Gene: ENSMUSG00000042185

DomainStartEndE-ValueType
low complexity region 209 234 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215211
AA Change: R280W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215544
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
A2ml1 T A 6: 128,553,330 probably null Het
Adsl C G 15: 80,963,909 P118A probably damaging Het
Ano6 C T 15: 95,962,241 P748L probably damaging Het
Arhgap10 A T 8: 77,420,072 N234K probably benign Het
Arhgap18 T A 10: 26,846,108 I25K possibly damaging Het
AW551984 T C 9: 39,597,185 Y345C probably damaging Het
Ccdc146 A G 5: 21,305,331 V561A probably benign Het
Cenpv G A 11: 62,527,572 T185M probably damaging Het
Fat2 T A 11: 55,262,337 D3683V probably damaging Het
Galns T C 8: 122,585,026 D415G possibly damaging Het
Gatad2a G A 8: 69,916,420 T259M probably damaging Het
Gja8 T C 3: 96,920,332 S5G probably benign Het
Gm13119 A T 4: 144,363,491 D367V probably damaging Het
Gm4951 A G 18: 60,246,070 I226V probably benign Het
Ifi209 T C 1: 173,638,976 S125P probably damaging Het
Il12rb2 G A 6: 67,292,262 R856W probably damaging Het
Kcnq3 A T 15: 65,997,773 Y605* probably null Het
Klk1b16 T C 7: 44,141,526 S251P probably benign Het
Map2 A G 1: 66,414,620 N890D probably damaging Het
Map4 T A 9: 110,034,678 S324T probably benign Het
Mmp28 T C 11: 83,442,858 D419G probably damaging Het
Mtnr1b A G 9: 15,862,914 L283P probably benign Het
Ndufb7 T A 8: 83,571,434 Y95N probably damaging Het
Npc1l1 A G 11: 6,224,245 Y687H probably damaging Het
Olfr1099 T A 2: 86,958,580 R293* probably null Het
Olfr308 A C 7: 86,321,671 F94V possibly damaging Het
Olfr889 C T 9: 38,116,627 T277I probably benign Het
Olfr919 T C 9: 38,697,647 T240A probably damaging Het
Pabpc4l T C 3: 46,446,609 D200G probably benign Het
Plekhg6 T C 6: 125,372,551 E361G possibly damaging Het
Rictor A G 15: 6,789,565 Y1423C probably damaging Het
Rsf1 G A 7: 97,680,695 D1143N probably damaging Het
Spsb4 C T 9: 96,995,574 probably null Het
Strada G T 11: 106,171,017 A136E probably damaging Het
Syce2 A T 8: 84,883,502 Q73L probably damaging Het
Teddm2 A T 1: 153,850,384 V195D probably benign Het
Tex36 A T 7: 133,601,983 N12K probably benign Het
Ubtf A G 11: 102,308,959 S484P probably benign Het
Ufd1 T G 16: 18,817,930 L66R probably damaging Het
Vmn2r74 C T 7: 85,951,989 A814T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Xrcc1 T A 7: 24,567,928 probably null Het
Zfp277 A C 12: 40,335,309 C305G probably damaging Het
Other mutations in Nfrkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Nfrkb APN 9 31389049 missense probably damaging 0.99
IGL01343:Nfrkb APN 9 31388954 missense probably damaging 0.99
IGL01363:Nfrkb APN 9 31414371 missense possibly damaging 0.53
IGL01647:Nfrkb APN 9 31396505 splice site probably benign
IGL01655:Nfrkb APN 9 31403459 missense probably benign 0.09
IGL01735:Nfrkb APN 9 31410139 missense possibly damaging 0.73
IGL01926:Nfrkb APN 9 31414179 missense probably benign 0.01
IGL01929:Nfrkb APN 9 31419873 missense possibly damaging 0.73
IGL02095:Nfrkb APN 9 31411231 missense probably damaging 0.97
IGL02370:Nfrkb APN 9 31389012 missense probably benign 0.08
IGL02525:Nfrkb APN 9 31414516 missense possibly damaging 0.73
R0325:Nfrkb UTSW 9 31414180 missense probably benign 0.06
R0390:Nfrkb UTSW 9 31388897 start gained probably benign
R0558:Nfrkb UTSW 9 31410268 missense possibly damaging 0.73
R0670:Nfrkb UTSW 9 31420173 missense probably benign 0.33
R1329:Nfrkb UTSW 9 31414647 missense possibly damaging 0.93
R1729:Nfrkb UTSW 9 31414636 missense probably benign 0.00
R1730:Nfrkb UTSW 9 31414636 missense probably benign 0.00
R1894:Nfrkb UTSW 9 31414768 missense probably benign 0.02
R1975:Nfrkb UTSW 9 31414684 missense possibly damaging 0.86
R2022:Nfrkb UTSW 9 31411250 missense probably benign 0.04
R2175:Nfrkb UTSW 9 31389014 missense possibly damaging 0.73
R3793:Nfrkb UTSW 9 31409932 splice site probably benign
R4020:Nfrkb UTSW 9 31414111 missense possibly damaging 0.96
R4425:Nfrkb UTSW 9 31399962 missense probably damaging 0.99
R4727:Nfrkb UTSW 9 31403623 missense probably damaging 0.99
R4730:Nfrkb UTSW 9 31410251 missense probably benign 0.33
R4775:Nfrkb UTSW 9 31419049 missense possibly damaging 0.86
R5032:Nfrkb UTSW 9 31389055 splice site probably null
R5635:Nfrkb UTSW 9 31399298 missense probably damaging 0.98
R5712:Nfrkb UTSW 9 31414636 missense probably benign 0.00
R5720:Nfrkb UTSW 9 31394742 missense probably damaging 1.00
R6448:Nfrkb UTSW 9 31394789 missense probably damaging 1.00
R6543:Nfrkb UTSW 9 31400985 nonsense probably null
R6612:Nfrkb UTSW 9 31397006 nonsense probably null
R7087:Nfrkb UTSW 9 31419932 nonsense probably null
R7123:Nfrkb UTSW 9 31414015 critical splice acceptor site probably null
R7483:Nfrkb UTSW 9 31414032 nonsense probably null
T0975:Nfrkb UTSW 9 31397083 missense probably benign 0.04
Z1088:Nfrkb UTSW 9 31411333 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AATTAGTGGCACAGTGGGACC -3'
(R):5'- ACCATGCCTTGTAAAGTCAAAGTAC -3'

Sequencing Primer
(F):5'- CAGAGGCCTCGGTGCTTTTG -3'
(R):5'- CAAAGTACTTGACTGGCTTCTCATAC -3'
Posted On2016-10-24