Incidental Mutation 'R5532:Olfr919'
ID436228
Institutional Source Beutler Lab
Gene Symbol Olfr919
Ensembl Gene ENSMUSG00000056961
Gene Nameolfactory receptor 919
SynonymsMOR171-23, GA_x6K02T2PVTD-32400678-32399743
MMRRC Submission 043090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5532 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38696804-38703673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38697647 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 240 (T240A)
Ref Sequence ENSEMBL: ENSMUSP00000150303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071425] [ENSMUST00000215612] [ENSMUST00000217508]
Predicted Effect probably damaging
Transcript: ENSMUST00000071425
AA Change: T244A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071372
Gene: ENSMUSG00000056961
AA Change: T244A

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 9.8e-50 PFAM
Pfam:7tm_1 45 294 9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215612
AA Change: T240A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217508
AA Change: T240A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
A2ml1 T A 6: 128,553,330 probably null Het
Adsl C G 15: 80,963,909 P118A probably damaging Het
Ano6 C T 15: 95,962,241 P748L probably damaging Het
Arhgap10 A T 8: 77,420,072 N234K probably benign Het
Arhgap18 T A 10: 26,846,108 I25K possibly damaging Het
AW551984 T C 9: 39,597,185 Y345C probably damaging Het
Ccdc146 A G 5: 21,305,331 V561A probably benign Het
Cenpv G A 11: 62,527,572 T185M probably damaging Het
Fat2 T A 11: 55,262,337 D3683V probably damaging Het
Galns T C 8: 122,585,026 D415G possibly damaging Het
Gatad2a G A 8: 69,916,420 T259M probably damaging Het
Gja8 T C 3: 96,920,332 S5G probably benign Het
Gm13119 A T 4: 144,363,491 D367V probably damaging Het
Gm4951 A G 18: 60,246,070 I226V probably benign Het
Ifi209 T C 1: 173,638,976 S125P probably damaging Het
Il12rb2 G A 6: 67,292,262 R856W probably damaging Het
Kcnq3 A T 15: 65,997,773 Y605* probably null Het
Klk1b16 T C 7: 44,141,526 S251P probably benign Het
Map2 A G 1: 66,414,620 N890D probably damaging Het
Map4 T A 9: 110,034,678 S324T probably benign Het
Mmp28 T C 11: 83,442,858 D419G probably damaging Het
Mtnr1b A G 9: 15,862,914 L283P probably benign Het
Ndufb7 T A 8: 83,571,434 Y95N probably damaging Het
Nfrkb C T 9: 31,397,779 R280W probably damaging Het
Npc1l1 A G 11: 6,224,245 Y687H probably damaging Het
Olfr1099 T A 2: 86,958,580 R293* probably null Het
Olfr308 A C 7: 86,321,671 F94V possibly damaging Het
Olfr889 C T 9: 38,116,627 T277I probably benign Het
Pabpc4l T C 3: 46,446,609 D200G probably benign Het
Plekhg6 T C 6: 125,372,551 E361G possibly damaging Het
Rictor A G 15: 6,789,565 Y1423C probably damaging Het
Rsf1 G A 7: 97,680,695 D1143N probably damaging Het
Spsb4 C T 9: 96,995,574 probably null Het
Strada G T 11: 106,171,017 A136E probably damaging Het
Syce2 A T 8: 84,883,502 Q73L probably damaging Het
Teddm2 A T 1: 153,850,384 V195D probably benign Het
Tex36 A T 7: 133,601,983 N12K probably benign Het
Ubtf A G 11: 102,308,959 S484P probably benign Het
Ufd1 T G 16: 18,817,930 L66R probably damaging Het
Vmn2r74 C T 7: 85,951,989 A814T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Xrcc1 T A 7: 24,567,928 probably null Het
Zfp277 A C 12: 40,335,309 C305G probably damaging Het
Other mutations in Olfr919
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Olfr919 APN 9 38697905 missense probably benign 0.00
IGL02515:Olfr919 APN 9 38697791 missense probably benign 0.39
IGL02745:Olfr919 APN 9 38698198 missense probably damaging 0.99
H8562:Olfr919 UTSW 9 38697910 missense probably damaging 1.00
R1960:Olfr919 UTSW 9 38698204 missense probably benign 0.28
R1973:Olfr919 UTSW 9 38697868 missense probably damaging 0.96
R3119:Olfr919 UTSW 9 38697659 nonsense probably null
R4543:Olfr919 UTSW 9 38697545 missense possibly damaging 0.93
R4752:Olfr919 UTSW 9 38697970 missense probably damaging 0.99
R5474:Olfr919 UTSW 9 38698313 missense possibly damaging 0.69
R5635:Olfr919 UTSW 9 38698159 missense possibly damaging 0.64
R5940:Olfr919 UTSW 9 38697711 nonsense probably null
R6820:Olfr919 UTSW 9 38697475 missense possibly damaging 0.88
R7164:Olfr919 UTSW 9 38698219 missense possibly damaging 0.95
R7337:Olfr919 UTSW 9 38697865 missense probably benign 0.12
R7806:Olfr919 UTSW 9 38698271 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AACATCCCTATTCCTCAGGCTATAG -3'
(R):5'- CTGCATGCTAAGAGTGGTTTTC -3'

Sequencing Primer
(F):5'- CTATTCCTCAGGCTATAGATCATGGG -3'
(R):5'- CATGCTAAGAGTGGTTTTCTGTAAG -3'
Posted On2016-10-24