Incidental Mutation 'R0006:Tpm3'
ID43623
Institutional Source Beutler Lab
Gene Symbol Tpm3
Ensembl Gene ENSMUSG00000027940
Gene Nametropomyosin 3, gamma
SynonymsskalphaTM.2, Trop-5, Tpm5, hTMnm, Tm5NM, gamma-TM, Tpm-5, hTM30nm
MMRRC Submission 041980-MU
Accession Numbers

Ncbi RefSeq: NM_022314.3, NM_001253738.1, NM_001253740.1; MGI:1890149

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0006 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90072649-90100902 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 90087661 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029549] [ENSMUST00000118566] [ENSMUST00000119158] [ENSMUST00000119570] [ENSMUST00000121503] [ENSMUST00000127955] [ENSMUST00000149432]
Predicted Effect probably benign
Transcript: ENSMUST00000029549
SMART Domains Protein: ENSMUSP00000029549
Gene: ENSMUSG00000027940

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 3.9e-22 PFAM
Pfam:Tropomyosin 12 248 7.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118566
SMART Domains Protein: ENSMUSP00000113056
Gene: ENSMUSG00000027940

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 3 117 2e-21 PFAM
Pfam:Tropomyosin 12 248 1.7e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119158
SMART Domains Protein: ENSMUSP00000113219
Gene: ENSMUSG00000027940

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 1.7e-22 PFAM
Pfam:Tropomyosin 12 247 3.9e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119570
SMART Domains Protein: ENSMUSP00000113978
Gene: ENSMUSG00000027940

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 8 154 4.2e-35 PFAM
Pfam:CLZ 10 75 1.2e-9 PFAM
Pfam:Tropomyosin 49 285 3.7e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121503
SMART Domains Protein: ENSMUSP00000113578
Gene: ENSMUSG00000027940

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.3e-36 PFAM
Pfam:Tropomyosin 48 284 4.7e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149115
Predicted Effect probably benign
Transcript: ENSMUST00000149432
SMART Domains Protein: ENSMUSP00000114229
Gene: ENSMUSG00000027940

DomainStartEndE-ValueType
Pfam:Tropomyosin 1 70 1.6e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151798
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype Strain: 3040795
Lethality: E1-E3
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tropomyosin family of actin-binding proteins. Tropomyosins are dimers of coiled-coil proteins that provide stability to actin filaments and regulate access of other actin-binding proteins. Mutations in this gene result in autosomal dominant nemaline myopathy and other muscle disorders. This locus is involved in translocations with other loci, including anaplastic lymphoma receptor tyrosine kinase (ALK) and neurotrophic tyrosine kinase receptor type 1 (NTRK1), which result in the formation of fusion proteins that act as oncogenes. There are numerous pseudogenes for this gene on different chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous inactivation of this gene results in early embryonic death, prior to blastocyst formation. Mice homozygous for a targeted allele lacking exon 9 exhibit dysmorphic T-tubules and contraction in skeletal muscles. [provided by MGI curators]
Allele List at MGI

All alleles(76) : Targeted(5) Gene trapped(71)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Tpm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Tpm3 APN 3 90087717 missense probably damaging 0.99
IGL00949:Tpm3 APN 3 90089858 missense probably damaging 1.00
IGL01955:Tpm3 APN 3 90088435 missense probably benign 0.00
IGL01970:Tpm3 APN 3 90089828 missense probably damaging 1.00
IGL02605:Tpm3 APN 3 90088446 missense probably benign 0.13
IGL03352:Tpm3 APN 3 90087745 critical splice donor site probably null
IGL03375:Tpm3 APN 3 90073772 missense possibly damaging 0.83
P0045:Tpm3 UTSW 3 90091093 critical splice donor site probably null
R0006:Tpm3 UTSW 3 90087661 splice site probably benign
R0024:Tpm3 UTSW 3 90087449 splice site probably null
R0086:Tpm3 UTSW 3 90090092 unclassified probably benign
R1487:Tpm3 UTSW 3 90090082 splice site probably null
R5235:Tpm3 UTSW 3 90086495 missense probably damaging 1.00
R6639:Tpm3 UTSW 3 90079802 missense probably damaging 0.99
R7089:Tpm3 UTSW 3 90072722 start gained probably benign
R7212:Tpm3 UTSW 3 90091054 missense probably benign
R7867:Tpm3 UTSW 3 90086468 missense probably damaging 1.00
R7950:Tpm3 UTSW 3 90086468 missense probably damaging 1.00
X0020:Tpm3 UTSW 3 90087574 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCAGCTCAGAATGTCATTGCTGTG -3'
(R):5'- TACTCGGAATTAGTGCCCAAGCAGG -3'

Sequencing Primer
(F):5'- CATTCTGTTTCCGGCAGAGG -3'
(R):5'- CCCAAGCAGGCAGGATG -3'
Posted On2013-05-29