Incidental Mutation 'R5532:Strada'
ID436238
Institutional Source Beutler Lab
Gene Symbol Strada
Ensembl Gene ENSMUSG00000069631
Gene NameSTE20-related kinase adaptor alpha
Synonyms2610019A05Rik, 6030402H20Rik
MMRRC Submission 043090-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock #R5532 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106163330-106202168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 106171017 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 136 (A136E)
Ref Sequence ENSEMBL: ENSMUSP00000115555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007444] [ENSMUST00000103072] [ENSMUST00000152008]
Predicted Effect probably damaging
Transcript: ENSMUST00000007444
AA Change: A173E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007444
Gene: ENSMUSG00000069631
AA Change: A173E

DomainStartEndE-ValueType
Pfam:Pkinase 69 379 2.4e-37 PFAM
Pfam:Pkinase_Tyr 70 302 2.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103072
AA Change: A136E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099361
Gene: ENSMUSG00000069631
AA Change: A136E

DomainStartEndE-ValueType
Pfam:Pkinase 32 342 2.2e-35 PFAM
Pfam:Pkinase_Tyr 33 266 2.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122989
Predicted Effect probably damaging
Transcript: ENSMUST00000152008
AA Change: A136E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115555
Gene: ENSMUSG00000069631
AA Change: A136E

DomainStartEndE-ValueType
Pfam:Pkinase 32 159 7.4e-16 PFAM
Pfam:Pkinase_Tyr 33 159 1.5e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a STE20-like kinase domain, but lacks several residues that are critical for catalytic activity, so it is termed a 'pseudokinase'. The protein forms a heterotrimeric complex with serine/threonine kinase 11 (STK11, also known as LKB1) and the scaffolding protein calcium binding protein 39 (CAB39, also known as MO25). The protein activates STK11 leading to the phosphorylation of both proteins and excluding STK11 from the nucleus. The protein is necessary for STK11-induced G1 cell cycle arrest. A mutation in this gene has been shown to result in polyhydramnios, megalencephaly, and symptomatic epilepsy (PMSE) syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their full-length nature is not known. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
A2ml1 T A 6: 128,553,330 probably null Het
Adsl C G 15: 80,963,909 P118A probably damaging Het
Ano6 C T 15: 95,962,241 P748L probably damaging Het
Arhgap10 A T 8: 77,420,072 N234K probably benign Het
Arhgap18 T A 10: 26,846,108 I25K possibly damaging Het
AW551984 T C 9: 39,597,185 Y345C probably damaging Het
Ccdc146 A G 5: 21,305,331 V561A probably benign Het
Cenpv G A 11: 62,527,572 T185M probably damaging Het
Fat2 T A 11: 55,262,337 D3683V probably damaging Het
Galns T C 8: 122,585,026 D415G possibly damaging Het
Gatad2a G A 8: 69,916,420 T259M probably damaging Het
Gja8 T C 3: 96,920,332 S5G probably benign Het
Gm13119 A T 4: 144,363,491 D367V probably damaging Het
Gm4951 A G 18: 60,246,070 I226V probably benign Het
Ifi209 T C 1: 173,638,976 S125P probably damaging Het
Il12rb2 G A 6: 67,292,262 R856W probably damaging Het
Kcnq3 A T 15: 65,997,773 Y605* probably null Het
Klk1b16 T C 7: 44,141,526 S251P probably benign Het
Map2 A G 1: 66,414,620 N890D probably damaging Het
Map4 T A 9: 110,034,678 S324T probably benign Het
Mmp28 T C 11: 83,442,858 D419G probably damaging Het
Mtnr1b A G 9: 15,862,914 L283P probably benign Het
Ndufb7 T A 8: 83,571,434 Y95N probably damaging Het
Nfrkb C T 9: 31,397,779 R280W probably damaging Het
Npc1l1 A G 11: 6,224,245 Y687H probably damaging Het
Olfr1099 T A 2: 86,958,580 R293* probably null Het
Olfr308 A C 7: 86,321,671 F94V possibly damaging Het
Olfr889 C T 9: 38,116,627 T277I probably benign Het
Olfr919 T C 9: 38,697,647 T240A probably damaging Het
Pabpc4l T C 3: 46,446,609 D200G probably benign Het
Plekhg6 T C 6: 125,372,551 E361G possibly damaging Het
Rictor A G 15: 6,789,565 Y1423C probably damaging Het
Rsf1 G A 7: 97,680,695 D1143N probably damaging Het
Spsb4 C T 9: 96,995,574 probably null Het
Syce2 A T 8: 84,883,502 Q73L probably damaging Het
Teddm2 A T 1: 153,850,384 V195D probably benign Het
Tex36 A T 7: 133,601,983 N12K probably benign Het
Ubtf A G 11: 102,308,959 S484P probably benign Het
Ufd1 T G 16: 18,817,930 L66R probably damaging Het
Vmn2r74 C T 7: 85,951,989 A814T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Xrcc1 T A 7: 24,567,928 probably null Het
Zfp277 A C 12: 40,335,309 C305G probably damaging Het
Other mutations in Strada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Strada APN 11 106171150 splice site probably benign
IGL00870:Strada APN 11 106171257 missense probably damaging 1.00
IGL01564:Strada APN 11 106173292 missense probably damaging 1.00
IGL02508:Strada APN 11 106168356 missense probably benign 0.03
IGL02816:Strada APN 11 106164425 unclassified probably benign
IGL03008:Strada APN 11 106170957 missense probably damaging 1.00
IGL03107:Strada APN 11 106164037 unclassified probably benign
R0587:Strada UTSW 11 106170964 missense probably damaging 1.00
R1614:Strada UTSW 11 106168319 missense probably damaging 1.00
R1764:Strada UTSW 11 106164184 missense probably damaging 0.96
R1852:Strada UTSW 11 106171221 missense possibly damaging 0.65
R3772:Strada UTSW 11 106164822 missense probably damaging 0.99
R4329:Strada UTSW 11 106187173 utr 5 prime probably benign
R4538:Strada UTSW 11 106167825 missense probably damaging 1.00
R6102:Strada UTSW 11 106168436 missense probably benign 0.01
R6135:Strada UTSW 11 106173314 missense probably damaging 0.99
R6337:Strada UTSW 11 106173317 missense possibly damaging 0.80
R6773:Strada UTSW 11 106164907 missense probably damaging 0.99
R7155:Strada UTSW 11 106171039 missense probably damaging 1.00
R7509:Strada UTSW 11 106187094 missense unknown
R7552:Strada UTSW 11 106187004 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTGGTCCACAGCAGATGTC -3'
(R):5'- CAATATAGTACCGTATCGAGCCACC -3'

Sequencing Primer
(F):5'- GTCCACAGCAGATGTCCCTCAC -3'
(R):5'- CGCAGATAATGAGCTGTGGGTC -3'
Posted On2016-10-24