Incidental Mutation 'R5546:Ahctf1'
ID436257
Institutional Source Beutler Lab
Gene Symbol Ahctf1
Ensembl Gene ENSMUSG00000026491
Gene NameAT hook containing transcription factor 1
Synonyms6230412P20Rik, Elys
MMRRC Submission 043104-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5546 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location179744894-179803680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 179754068 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1523 (I1523N)
Ref Sequence ENSEMBL: ENSMUSP00000027768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027768] [ENSMUST00000125816]
PDB Structure
Nucleoporin ELYS (aa1-494), Mus musculus [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027768
AA Change: I1523N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000027768
Gene: ENSMUSG00000026491
AA Change: I1523N

DomainStartEndE-ValueType
Pfam:ELYS-bb 1 489 1.6e-307 PFAM
Pfam:ELYS 722 955 2.5e-58 PFAM
low complexity region 1138 1155 N/A INTRINSIC
low complexity region 1180 1192 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1597 1610 N/A INTRINSIC
low complexity region 1684 1694 N/A INTRINSIC
low complexity region 1834 1841 N/A INTRINSIC
low complexity region 1918 1935 N/A INTRINSIC
AT_hook 1955 1967 3.35e-1 SMART
low complexity region 2060 2066 N/A INTRINSIC
low complexity region 2073 2084 N/A INTRINSIC
low complexity region 2096 2108 N/A INTRINSIC
Blast:KISc 2164 2217 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000125816
Predicted Effect probably benign
Transcript: ENSMUST00000140489
SMART Domains Protein: ENSMUSP00000115253
Gene: ENSMUSG00000026491

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151734
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice die between E3.5 and E5.5. The inner cell mass cells exhibit impaired proliferation and apoptosis when grown in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,929,633 N385S probably benign Het
Akna C T 4: 63,394,959 G309E probably benign Het
Akna T C 4: 63,395,566 N107D probably benign Het
Arhgef15 G A 11: 68,954,051 P240L probably benign Het
Brd1 T A 15: 88,701,122 E836D probably benign Het
Brf2 A G 8: 27,124,283 S292P possibly damaging Het
C3 A G 17: 57,222,976 L500P probably damaging Het
Ccdc107 T C 4: 43,495,685 L196P probably damaging Het
Cdcp1 G T 9: 123,178,029 P551Q probably damaging Het
Ckap5 T C 2: 91,594,816 L1224P probably damaging Het
Csnk1g2 C A 10: 80,638,398 T178K probably benign Het
Ctsq A T 13: 61,037,888 C146* probably null Het
Cyp2ab1 T A 16: 20,313,757 I264F probably damaging Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 33,912,641 probably benign Het
Dnah11 G A 12: 117,975,848 T3179M possibly damaging Het
Dnah7c A T 1: 46,666,317 T2497S probably damaging Het
Eif4enif1 T C 11: 3,243,989 V776A probably damaging Het
Erbb4 G T 1: 68,298,293 T622N probably damaging Het
Erich6 A G 3: 58,618,797 Y595H probably benign Het
Fam107a C T 14: 8,298,764 A121T probably benign Het
Gif T C 19: 11,748,495 S50P possibly damaging Het
Gpatch11 C T 17: 78,842,119 Q183* probably null Het
Gpr161 C A 1: 165,306,413 F81L possibly damaging Het
Hook1 G T 4: 96,002,528 E291D probably benign Het
Hsf2bp T A 17: 31,946,695 I309F probably damaging Het
Hspg2 T C 4: 137,548,174 probably null Het
Ide T G 19: 37,272,224 M910L unknown Het
Igdcc4 A G 9: 65,128,795 Y712C probably damaging Het
Kmt2d T C 15: 98,853,068 probably benign Het
Lats1 T C 10: 7,705,754 Y768H probably damaging Het
Mageb3 A G 2: 121,954,387 V278A probably damaging Het
Mapkbp1 G A 2: 120,019,243 R732H probably damaging Het
Marveld2 T C 13: 100,600,938 I148V probably benign Het
Mast1 G C 8: 84,916,260 P969A probably damaging Het
Myh10 T G 11: 68,798,380 V1261G possibly damaging Het
Nlrp1b A T 11: 71,217,276 H466Q probably benign Het
Npr2 T G 4: 43,650,150 V905G probably damaging Het
Oip5 T A 2: 119,610,327 I240F unknown Het
Olfr1259 A G 2: 89,943,585 C177R probably damaging Het
Olfr175-ps1 G T 16: 58,824,153 Y185* probably null Het
Olfr874 T A 9: 37,746,524 M130K probably benign Het
Pcsk2 G A 2: 143,546,560 A24T probably benign Het
Plxnb1 G T 9: 109,100,750 G225W probably damaging Het
Polr1a T C 6: 71,929,366 S389P possibly damaging Het
Prkca A G 11: 108,053,980 V175A probably benign Het
Rassf7 C A 7: 141,217,060 probably null Het
Rbl2 A G 8: 91,078,932 I206V probably benign Het
Rnf111 A T 9: 70,459,096 H353Q probably benign Het
Rpn1 T G 6: 88,093,859 V237G probably damaging Het
Sec61a2 T A 2: 5,876,540 I267F possibly damaging Het
Spop G T 11: 95,485,843 V241F probably damaging Het
Sptbn2 C T 19: 4,725,950 A178V probably damaging Het
Stard13 A G 5: 151,045,901 Y791H probably benign Het
Susd2 T A 10: 75,642,218 I113L probably benign Het
Tcof1 T C 18: 60,831,556 E666G possibly damaging Het
Tekt5 G T 16: 10,361,390 A371E possibly damaging Het
Thap11 G A 8: 105,855,916 E186K probably damaging Het
Tk2 A T 8: 104,247,683 D45E possibly damaging Het
Tuba8 C A 6: 121,222,913 Y185* probably null Het
Usp24 T A 4: 106,416,047 Y2210N probably damaging Het
Wfdc8 A T 2: 164,597,319 probably benign Het
Zar1l T C 5: 150,512,900 N237S probably damaging Het
Zfp607b A T 7: 27,702,607 T163S probably benign Het
Zfp619 C A 7: 39,535,153 H202Q probably benign Het
Other mutations in Ahctf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Ahctf1 APN 1 179769131 missense probably damaging 1.00
IGL01714:Ahctf1 APN 1 179795877 missense probably damaging 0.99
IGL01787:Ahctf1 APN 1 179753322 missense probably benign
IGL01997:Ahctf1 APN 1 179755462 missense probably damaging 0.99
IGL02035:Ahctf1 APN 1 179766014 missense probably benign 0.00
IGL02158:Ahctf1 APN 1 179779652 missense possibly damaging 0.64
IGL02182:Ahctf1 APN 1 179753078 missense probably benign 0.00
IGL02298:Ahctf1 APN 1 179752479 missense probably benign 0.00
IGL02325:Ahctf1 APN 1 179776015 missense probably benign 0.14
IGL02619:Ahctf1 APN 1 179792451 missense possibly damaging 0.90
IGL02858:Ahctf1 APN 1 179769034 missense probably damaging 0.96
IGL02893:Ahctf1 APN 1 179776011 nonsense probably null
IGL02895:Ahctf1 APN 1 179793811 missense probably damaging 1.00
IGL03180:Ahctf1 APN 1 179775330 critical splice donor site probably null
IGL03220:Ahctf1 APN 1 179788202 missense probably benign 0.01
cerebro UTSW 1 179769414 missense probably damaging 0.99
R0003:Ahctf1 UTSW 1 179763473 missense probably benign 0.04
R0024:Ahctf1 UTSW 1 179752436 missense probably damaging 0.98
R0030:Ahctf1 UTSW 1 179752436 missense probably damaging 0.98
R0432:Ahctf1 UTSW 1 179784161 missense probably damaging 0.98
R0481:Ahctf1 UTSW 1 179760271 missense probably benign 0.00
R0600:Ahctf1 UTSW 1 179763468 critical splice donor site probably null
R0613:Ahctf1 UTSW 1 179769414 missense probably damaging 0.99
R0814:Ahctf1 UTSW 1 179762908 missense probably benign 0.26
R1055:Ahctf1 UTSW 1 179763486 missense possibly damaging 0.46
R1473:Ahctf1 UTSW 1 179776108 missense probably benign 0.30
R1473:Ahctf1 UTSW 1 179799279 missense probably damaging 0.99
R1689:Ahctf1 UTSW 1 179768383 missense probably damaging 0.96
R1778:Ahctf1 UTSW 1 179753015 missense possibly damaging 0.57
R1878:Ahctf1 UTSW 1 179775509 missense possibly damaging 0.96
R1925:Ahctf1 UTSW 1 179770653 missense probably damaging 0.98
R2118:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2122:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2124:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2373:Ahctf1 UTSW 1 179795796 missense probably damaging 1.00
R2509:Ahctf1 UTSW 1 179770693 missense possibly damaging 0.51
R2697:Ahctf1 UTSW 1 179752532 missense probably damaging 0.99
R3035:Ahctf1 UTSW 1 179753870 missense probably damaging 1.00
R3155:Ahctf1 UTSW 1 179755583 missense probably damaging 0.98
R3899:Ahctf1 UTSW 1 179777780 missense possibly damaging 0.95
R4036:Ahctf1 UTSW 1 179762616 missense possibly damaging 0.61
R4681:Ahctf1 UTSW 1 179752796 missense probably benign 0.27
R4695:Ahctf1 UTSW 1 179753054 missense possibly damaging 0.78
R4735:Ahctf1 UTSW 1 179753399 missense probably benign 0.00
R4857:Ahctf1 UTSW 1 179799357 unclassified probably benign
R4898:Ahctf1 UTSW 1 179755512 missense probably benign 0.02
R4905:Ahctf1 UTSW 1 179748627 missense probably damaging 1.00
R5011:Ahctf1 UTSW 1 179784110 missense possibly damaging 0.92
R5013:Ahctf1 UTSW 1 179784110 missense possibly damaging 0.92
R5053:Ahctf1 UTSW 1 179786784 missense possibly damaging 0.82
R5207:Ahctf1 UTSW 1 179793594 intron probably benign
R5319:Ahctf1 UTSW 1 179769050 missense probably damaging 1.00
R5343:Ahctf1 UTSW 1 179770634 nonsense probably null
R5718:Ahctf1 UTSW 1 179769339 missense possibly damaging 0.54
R5862:Ahctf1 UTSW 1 179788330 missense probably damaging 1.00
R5958:Ahctf1 UTSW 1 179746542 unclassified probably benign
R6010:Ahctf1 UTSW 1 179795813 missense possibly damaging 0.80
R6081:Ahctf1 UTSW 1 179781672 missense probably benign 0.07
R6093:Ahctf1 UTSW 1 179762952 missense probably benign 0.01
R6207:Ahctf1 UTSW 1 179777390 intron probably null
R6268:Ahctf1 UTSW 1 179763483 missense probably benign 0.08
R6656:Ahctf1 UTSW 1 179753513 missense probably benign 0.05
R6668:Ahctf1 UTSW 1 179752407 missense probably benign 0.04
R6788:Ahctf1 UTSW 1 179752634 missense probably benign 0.00
R6860:Ahctf1 UTSW 1 179753288 missense probably benign 0.04
R6998:Ahctf1 UTSW 1 179770915 nonsense probably null
R7082:Ahctf1 UTSW 1 179775333 missense probably benign 0.15
R7385:Ahctf1 UTSW 1 179753381 missense possibly damaging 0.66
R7414:Ahctf1 UTSW 1 179784105 missense probably benign 0.00
R7663:Ahctf1 UTSW 1 179790314 missense possibly damaging 0.66
R7673:Ahctf1 UTSW 1 179762846 missense probably benign 0.02
R7715:Ahctf1 UTSW 1 179770848 missense probably benign 0.00
R7819:Ahctf1 UTSW 1 179768315 missense probably benign
R7846:Ahctf1 UTSW 1 179787073 missense probably damaging 0.99
R7912:Ahctf1 UTSW 1 179753091 missense probably benign 0.00
R7929:Ahctf1 UTSW 1 179787073 missense probably damaging 0.99
R7993:Ahctf1 UTSW 1 179753091 missense probably benign 0.00
X0067:Ahctf1 UTSW 1 179777704 missense probably damaging 0.99
Z1177:Ahctf1 UTSW 1 179793730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCATCACATTCAGCAG -3'
(R):5'- ACGGGGATCATGCTGTTTAG -3'

Sequencing Primer
(F):5'- CAGAGTCTTTGTCATCAGGCAAGTC -3'
(R):5'- GTGGGATTTCTAGTTTAATTCCATCC -3'
Posted On2016-10-24