Incidental Mutation 'R5546:Pcsk2'
ID436265
Institutional Source Beutler Lab
Gene Symbol Pcsk2
Ensembl Gene ENSMUSG00000027419
Gene Nameproprotein convertase subtilisin/kexin type 2
SynonymsPhpp-2, SPC2, Nec2, PC2, Nec-2, prohormone convertase 2, 6330411F23Rik
MMRRC Submission 043104-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R5546 (G1)
Quality Score215
Status Not validated
Chromosome2
Chromosomal Location143546156-143816285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143546560 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 24 (A24T)
Ref Sequence ENSEMBL: ENSMUSP00000028905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028905]
Predicted Effect probably benign
Transcript: ENSMUST00000028905
AA Change: A24T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000028905
Gene: ENSMUSG00000027419
AA Change: A24T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:S8_pro-domain 32 108 2.9e-21 PFAM
Pfam:Peptidase_S8 157 444 5e-44 PFAM
Pfam:P_proprotein 503 590 4.3e-28 PFAM
low complexity region 617 630 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156780
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The protein undergoes an initial autocatalytic processing event and interacts with a neuroendocrine secretory protein in the ER, exits the ER and sorts to secretory granules, where it is cleaved and catalytically activated during intracellular transport. The encoded protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Single nucleotide polymorphisms in this gene may increase susceptibility to myocardial infarction and type 2 diabetes. This gene may also play a role in tumor development and progression. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruptions of this gene display abnormalities in the maturation of peptide hormones leading to reduced female fertility, increased blood pressure on a high salt diet, and abnormal glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,929,633 N385S probably benign Het
Ahctf1 A T 1: 179,754,068 I1523N probably benign Het
Akna C T 4: 63,394,959 G309E probably benign Het
Akna T C 4: 63,395,566 N107D probably benign Het
Arhgef15 G A 11: 68,954,051 P240L probably benign Het
Brd1 T A 15: 88,701,122 E836D probably benign Het
Brf2 A G 8: 27,124,283 S292P possibly damaging Het
C3 A G 17: 57,222,976 L500P probably damaging Het
Ccdc107 T C 4: 43,495,685 L196P probably damaging Het
Cdcp1 G T 9: 123,178,029 P551Q probably damaging Het
Ckap5 T C 2: 91,594,816 L1224P probably damaging Het
Csnk1g2 C A 10: 80,638,398 T178K probably benign Het
Ctsq A T 13: 61,037,888 C146* probably null Het
Cyp2ab1 T A 16: 20,313,757 I264F probably damaging Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 33,912,641 probably benign Het
Dnah11 G A 12: 117,975,848 T3179M possibly damaging Het
Dnah7c A T 1: 46,666,317 T2497S probably damaging Het
Eif4enif1 T C 11: 3,243,989 V776A probably damaging Het
Erbb4 G T 1: 68,298,293 T622N probably damaging Het
Erich6 A G 3: 58,618,797 Y595H probably benign Het
Fam107a C T 14: 8,298,764 A121T probably benign Het
Gif T C 19: 11,748,495 S50P possibly damaging Het
Gpatch11 C T 17: 78,842,119 Q183* probably null Het
Gpr161 C A 1: 165,306,413 F81L possibly damaging Het
Hook1 G T 4: 96,002,528 E291D probably benign Het
Hsf2bp T A 17: 31,946,695 I309F probably damaging Het
Hspg2 T C 4: 137,548,174 probably null Het
Ide T G 19: 37,272,224 M910L unknown Het
Igdcc4 A G 9: 65,128,795 Y712C probably damaging Het
Kmt2d T C 15: 98,853,068 probably benign Het
Lats1 T C 10: 7,705,754 Y768H probably damaging Het
Mageb3 A G 2: 121,954,387 V278A probably damaging Het
Mapkbp1 G A 2: 120,019,243 R732H probably damaging Het
Marveld2 T C 13: 100,600,938 I148V probably benign Het
Mast1 G C 8: 84,916,260 P969A probably damaging Het
Myh10 T G 11: 68,798,380 V1261G possibly damaging Het
Nlrp1b A T 11: 71,217,276 H466Q probably benign Het
Npr2 T G 4: 43,650,150 V905G probably damaging Het
Oip5 T A 2: 119,610,327 I240F unknown Het
Olfr1259 A G 2: 89,943,585 C177R probably damaging Het
Olfr175-ps1 G T 16: 58,824,153 Y185* probably null Het
Olfr874 T A 9: 37,746,524 M130K probably benign Het
Plxnb1 G T 9: 109,100,750 G225W probably damaging Het
Polr1a T C 6: 71,929,366 S389P possibly damaging Het
Prkca A G 11: 108,053,980 V175A probably benign Het
Rassf7 C A 7: 141,217,060 probably null Het
Rbl2 A G 8: 91,078,932 I206V probably benign Het
Rnf111 A T 9: 70,459,096 H353Q probably benign Het
Rpn1 T G 6: 88,093,859 V237G probably damaging Het
Sec61a2 T A 2: 5,876,540 I267F possibly damaging Het
Spop G T 11: 95,485,843 V241F probably damaging Het
Sptbn2 C T 19: 4,725,950 A178V probably damaging Het
Stard13 A G 5: 151,045,901 Y791H probably benign Het
Susd2 T A 10: 75,642,218 I113L probably benign Het
Tcof1 T C 18: 60,831,556 E666G possibly damaging Het
Tekt5 G T 16: 10,361,390 A371E possibly damaging Het
Thap11 G A 8: 105,855,916 E186K probably damaging Het
Tk2 A T 8: 104,247,683 D45E possibly damaging Het
Tuba8 C A 6: 121,222,913 Y185* probably null Het
Usp24 T A 4: 106,416,047 Y2210N probably damaging Het
Wfdc8 A T 2: 164,597,319 probably benign Het
Zar1l T C 5: 150,512,900 N237S probably damaging Het
Zfp607b A T 7: 27,702,607 T163S probably benign Het
Zfp619 C A 7: 39,535,153 H202Q probably benign Het
Other mutations in Pcsk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Pcsk2 APN 2 143793239 missense probably damaging 1.00
IGL01609:Pcsk2 APN 2 143801158 missense possibly damaging 0.88
IGL01690:Pcsk2 APN 2 143687570 missense probably benign
IGL01833:Pcsk2 APN 2 143687580 missense possibly damaging 0.62
IGL01962:Pcsk2 APN 2 143813632 nonsense probably null
IGL02219:Pcsk2 APN 2 143793125 missense probably damaging 1.00
IGL02572:Pcsk2 APN 2 143690342 missense probably damaging 1.00
IGL02752:Pcsk2 APN 2 143773945 missense probably benign 0.09
P0035:Pcsk2 UTSW 2 143795951 missense probably damaging 1.00
R0092:Pcsk2 UTSW 2 143801024 missense probably damaging 1.00
R1424:Pcsk2 UTSW 2 143573428 splice site probably benign
R1470:Pcsk2 UTSW 2 143546518 nonsense probably null
R1470:Pcsk2 UTSW 2 143546518 nonsense probably null
R1832:Pcsk2 UTSW 2 143793269 missense probably damaging 1.00
R1993:Pcsk2 UTSW 2 143687619 missense probably benign 0.00
R4615:Pcsk2 UTSW 2 143795969 missense probably damaging 1.00
R4783:Pcsk2 UTSW 2 143687679 critical splice donor site probably null
R4796:Pcsk2 UTSW 2 143813425 missense probably benign 0.16
R4827:Pcsk2 UTSW 2 143801179 nonsense probably null
R5357:Pcsk2 UTSW 2 143573464 missense probably benign 0.00
R5413:Pcsk2 UTSW 2 143696700 splice site probably null
R5440:Pcsk2 UTSW 2 143546543 missense probably benign 0.22
R5605:Pcsk2 UTSW 2 143749245 intron probably benign
R5821:Pcsk2 UTSW 2 143749115 splice site probably null
R5905:Pcsk2 UTSW 2 143749140 missense probably damaging 0.98
R6120:Pcsk2 UTSW 2 143801111 missense probably damaging 1.00
R6135:Pcsk2 UTSW 2 143573540 missense possibly damaging 0.63
R6657:Pcsk2 UTSW 2 143690366 missense probably damaging 1.00
R6925:Pcsk2 UTSW 2 143813747 missense probably damaging 1.00
R7223:Pcsk2 UTSW 2 143690333 missense possibly damaging 0.95
R7289:Pcsk2 UTSW 2 143690423 missense probably damaging 1.00
R8043:Pcsk2 UTSW 2 143813530 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGTGGACAGCGTACAGATTTG -3'
(R):5'- AACGAGATTGCGCAAGGCTG -3'

Sequencing Primer
(F):5'- CAGATTTGCTGTTTGCCAAGC -3'
(R):5'- TGTCCCTCCTCTGGAAACAACATG -3'
Posted On2016-10-24