Incidental Mutation 'R5546:Wfdc8'
ID 436266
Institutional Source Beutler Lab
Gene Symbol Wfdc8
Ensembl Gene ENSMUSG00000070533
Gene Name WAP four-disulfide core domain 8
Synonyms LOC277343
MMRRC Submission 043104-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5546 (G1)
Quality Score 199
Status Not validated
Chromosome 2
Chromosomal Location 164438378-164455545 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) A to T at 164439239 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094351] [ENSMUST00000103100] [ENSMUST00000109338] [ENSMUST00000109339]
AlphaFold Q4KUS1
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083863
Predicted Effect probably benign
Transcript: ENSMUST00000094351
SMART Domains Protein: ENSMUSP00000091911
Gene: ENSMUSG00000070533

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103100
SMART Domains Protein: ENSMUSP00000099389
Gene: ENSMUSG00000017733

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
WAP 32 73 3.09e-3 SMART
KU 75 128 1.05e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109338
SMART Domains Protein: ENSMUSP00000104962
Gene: ENSMUSG00000070533

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
WAP 229 272 1.84e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000109339
AA Change: L381H
SMART Domains Protein: ENSMUSP00000104963
Gene: ENSMUSG00000070533
AA Change: L381H

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
low complexity region 300 313 N/A INTRINSIC
low complexity region 384 393 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. The encoded protein contains a Kunitz-inhibitor domain, in addition to three WFDC domains. Most WFDC genes are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. Two alternatively spliced transcript variants have been found for this gene, and they encode the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,806,832 (GRCm39) N385S probably benign Het
Ahctf1 A T 1: 179,581,633 (GRCm39) I1523N probably benign Het
Akna C T 4: 63,313,196 (GRCm39) G309E probably benign Het
Akna T C 4: 63,313,803 (GRCm39) N107D probably benign Het
Arhgef15 G A 11: 68,844,877 (GRCm39) P240L probably benign Het
Brd1 T A 15: 88,585,325 (GRCm39) E836D probably benign Het
Brf2 A G 8: 27,614,311 (GRCm39) S292P possibly damaging Het
C3 A G 17: 57,529,976 (GRCm39) L500P probably damaging Het
Cblif T C 19: 11,725,859 (GRCm39) S50P possibly damaging Het
Ccdc107 T C 4: 43,495,685 (GRCm39) L196P probably damaging Het
Cdcp1 G T 9: 123,007,094 (GRCm39) P551Q probably damaging Het
Ckap5 T C 2: 91,425,161 (GRCm39) L1224P probably damaging Het
Csnk1g2 C A 10: 80,474,232 (GRCm39) T178K probably benign Het
Ctsq A T 13: 61,185,702 (GRCm39) C146* probably null Het
Cyp2ab1 T A 16: 20,132,507 (GRCm39) I264F probably damaging Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 34,131,615 (GRCm39) probably benign Het
Dnah11 G A 12: 117,939,583 (GRCm39) T3179M possibly damaging Het
Dnah7c A T 1: 46,705,477 (GRCm39) T2497S probably damaging Het
Eif4enif1 T C 11: 3,193,989 (GRCm39) V776A probably damaging Het
Erbb4 G T 1: 68,337,452 (GRCm39) T622N probably damaging Het
Erich6 A G 3: 58,526,218 (GRCm39) Y595H probably benign Het
Fam107a C T 14: 8,298,764 (GRCm38) A121T probably benign Het
Gpatch11 C T 17: 79,149,548 (GRCm39) Q183* probably null Het
Gpr161 C A 1: 165,133,982 (GRCm39) F81L possibly damaging Het
Hook1 G T 4: 95,890,765 (GRCm39) E291D probably benign Het
Hsf2bp T A 17: 32,165,669 (GRCm39) I309F probably damaging Het
Hspg2 T C 4: 137,275,485 (GRCm39) probably null Het
Ide T G 19: 37,249,623 (GRCm39) M910L unknown Het
Igdcc4 A G 9: 65,036,077 (GRCm39) Y712C probably damaging Het
Kmt2d T C 15: 98,750,949 (GRCm39) probably benign Het
Lats1 T C 10: 7,581,518 (GRCm39) Y768H probably damaging Het
Mageb3 A G 2: 121,784,868 (GRCm39) V278A probably damaging Het
Mapkbp1 G A 2: 119,849,724 (GRCm39) R732H probably damaging Het
Marveld2 T C 13: 100,737,446 (GRCm39) I148V probably benign Het
Mast1 G C 8: 85,642,889 (GRCm39) P969A probably damaging Het
Myh10 T G 11: 68,689,206 (GRCm39) V1261G possibly damaging Het
Nlrp1b A T 11: 71,108,102 (GRCm39) H466Q probably benign Het
Npr2 T G 4: 43,650,150 (GRCm39) V905G probably damaging Het
Oip5 T A 2: 119,440,808 (GRCm39) I240F unknown Het
Or4c12 A G 2: 89,773,929 (GRCm39) C177R probably damaging Het
Or5k8 G T 16: 58,644,516 (GRCm39) Y185* probably null Het
Or8b12 T A 9: 37,657,820 (GRCm39) M130K probably benign Het
Pcsk2 G A 2: 143,388,480 (GRCm39) A24T probably benign Het
Plxnb1 G T 9: 108,929,818 (GRCm39) G225W probably damaging Het
Polr1a T C 6: 71,906,350 (GRCm39) S389P possibly damaging Het
Prkca A G 11: 107,944,806 (GRCm39) V175A probably benign Het
Rassf7 C A 7: 140,796,973 (GRCm39) probably null Het
Rbl2 A G 8: 91,805,560 (GRCm39) I206V probably benign Het
Rnf111 A T 9: 70,366,378 (GRCm39) H353Q probably benign Het
Rpn1 T G 6: 88,070,841 (GRCm39) V237G probably damaging Het
Sec61a2 T A 2: 5,881,351 (GRCm39) I267F possibly damaging Het
Spop G T 11: 95,376,669 (GRCm39) V241F probably damaging Het
Sptbn2 C T 19: 4,775,978 (GRCm39) A178V probably damaging Het
Stard13 A G 5: 150,969,366 (GRCm39) Y791H probably benign Het
Susd2 T A 10: 75,478,052 (GRCm39) I113L probably benign Het
Tcof1 T C 18: 60,964,628 (GRCm39) E666G possibly damaging Het
Tekt5 G T 16: 10,179,254 (GRCm39) A371E possibly damaging Het
Thap11 G A 8: 106,582,548 (GRCm39) E186K probably damaging Het
Tk2 A T 8: 104,974,315 (GRCm39) D45E possibly damaging Het
Tuba8 C A 6: 121,199,872 (GRCm39) Y185* probably null Het
Usp24 T A 4: 106,273,244 (GRCm39) Y2210N probably damaging Het
Zar1l T C 5: 150,436,365 (GRCm39) N237S probably damaging Het
Zfp607b A T 7: 27,402,032 (GRCm39) T163S probably benign Het
Zfp619 C A 7: 39,184,577 (GRCm39) H202Q probably benign Het
Other mutations in Wfdc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01896:Wfdc8 APN 2 164,447,700 (GRCm39) missense probably damaging 1.00
IGL02012:Wfdc8 APN 2 164,445,070 (GRCm39) splice site probably benign
IGL02831:Wfdc8 APN 2 164,447,685 (GRCm39) critical splice donor site probably null
PIT4131001:Wfdc8 UTSW 2 164,439,696 (GRCm39) missense possibly damaging 0.94
PIT4520001:Wfdc8 UTSW 2 164,445,223 (GRCm39) missense probably benign 0.09
R0006:Wfdc8 UTSW 2 164,440,984 (GRCm39) missense probably damaging 0.96
R0225:Wfdc8 UTSW 2 164,439,105 (GRCm39) missense probably benign 0.04
R0603:Wfdc8 UTSW 2 164,445,145 (GRCm39) missense probably damaging 1.00
R1741:Wfdc8 UTSW 2 164,450,789 (GRCm39) unclassified probably benign
R5484:Wfdc8 UTSW 2 164,439,649 (GRCm39) missense probably benign 0.11
R5614:Wfdc8 UTSW 2 164,445,123 (GRCm39) missense probably damaging 1.00
R5668:Wfdc8 UTSW 2 164,439,339 (GRCm39) utr 3 prime probably benign
R6410:Wfdc8 UTSW 2 164,439,663 (GRCm39) missense probably benign 0.10
R6869:Wfdc8 UTSW 2 164,441,012 (GRCm39) missense possibly damaging 0.82
R7726:Wfdc8 UTSW 2 164,441,906 (GRCm39) missense possibly damaging 0.77
R7770:Wfdc8 UTSW 2 164,439,594 (GRCm39) missense unknown
R8150:Wfdc8 UTSW 2 164,439,455 (GRCm39) nonsense probably null
R8424:Wfdc8 UTSW 2 164,445,078 (GRCm39) missense probably benign 0.03
R8783:Wfdc8 UTSW 2 164,447,769 (GRCm39) missense probably benign 0.41
R9094:Wfdc8 UTSW 2 164,439,245 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GTTTACCTGGATGCTAAGCTGGTC -3'
(R):5'- TCACTGGTCACCATGGACTG -3'

Sequencing Primer
(F):5'- GATGCTAAGCTGGTCCTCAG -3'
(R):5'- CATGGACTGGGCTTGAGC -3'
Posted On 2016-10-24