Incidental Mutation 'R5546:Erich6'
ID436267
Institutional Source Beutler Lab
Gene Symbol Erich6
Ensembl Gene ENSMUSG00000070471
Gene Nameglutamate rich 6
SynonymsFam194a, 4932431H17Rik
MMRRC Submission 043104-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5546 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location58616300-58637207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58618797 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 595 (Y595H)
Ref Sequence ENSEMBL: ENSMUSP00000040882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041115]
Predicted Effect probably benign
Transcript: ENSMUST00000041115
AA Change: Y595H

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040882
Gene: ENSMUSG00000070471
AA Change: Y595H

DomainStartEndE-ValueType
coiled coil region 27 77 N/A INTRINSIC
low complexity region 164 174 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
Pfam:FAM194 473 675 5.4e-67 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,929,633 N385S probably benign Het
Ahctf1 A T 1: 179,754,068 I1523N probably benign Het
Akna C T 4: 63,394,959 G309E probably benign Het
Akna T C 4: 63,395,566 N107D probably benign Het
Arhgef15 G A 11: 68,954,051 P240L probably benign Het
Brd1 T A 15: 88,701,122 E836D probably benign Het
Brf2 A G 8: 27,124,283 S292P possibly damaging Het
C3 A G 17: 57,222,976 L500P probably damaging Het
Ccdc107 T C 4: 43,495,685 L196P probably damaging Het
Cdcp1 G T 9: 123,178,029 P551Q probably damaging Het
Ckap5 T C 2: 91,594,816 L1224P probably damaging Het
Csnk1g2 C A 10: 80,638,398 T178K probably benign Het
Ctsq A T 13: 61,037,888 C146* probably null Het
Cyp2ab1 T A 16: 20,313,757 I264F probably damaging Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 33,912,641 probably benign Het
Dnah11 G A 12: 117,975,848 T3179M possibly damaging Het
Dnah7c A T 1: 46,666,317 T2497S probably damaging Het
Eif4enif1 T C 11: 3,243,989 V776A probably damaging Het
Erbb4 G T 1: 68,298,293 T622N probably damaging Het
Fam107a C T 14: 8,298,764 A121T probably benign Het
Gif T C 19: 11,748,495 S50P possibly damaging Het
Gpatch11 C T 17: 78,842,119 Q183* probably null Het
Gpr161 C A 1: 165,306,413 F81L possibly damaging Het
Hook1 G T 4: 96,002,528 E291D probably benign Het
Hsf2bp T A 17: 31,946,695 I309F probably damaging Het
Hspg2 T C 4: 137,548,174 probably null Het
Ide T G 19: 37,272,224 M910L unknown Het
Igdcc4 A G 9: 65,128,795 Y712C probably damaging Het
Kmt2d T C 15: 98,853,068 probably benign Het
Lats1 T C 10: 7,705,754 Y768H probably damaging Het
Mageb3 A G 2: 121,954,387 V278A probably damaging Het
Mapkbp1 G A 2: 120,019,243 R732H probably damaging Het
Marveld2 T C 13: 100,600,938 I148V probably benign Het
Mast1 G C 8: 84,916,260 P969A probably damaging Het
Myh10 T G 11: 68,798,380 V1261G possibly damaging Het
Nlrp1b A T 11: 71,217,276 H466Q probably benign Het
Npr2 T G 4: 43,650,150 V905G probably damaging Het
Oip5 T A 2: 119,610,327 I240F unknown Het
Olfr1259 A G 2: 89,943,585 C177R probably damaging Het
Olfr175-ps1 G T 16: 58,824,153 Y185* probably null Het
Olfr874 T A 9: 37,746,524 M130K probably benign Het
Pcsk2 G A 2: 143,546,560 A24T probably benign Het
Plxnb1 G T 9: 109,100,750 G225W probably damaging Het
Polr1a T C 6: 71,929,366 S389P possibly damaging Het
Prkca A G 11: 108,053,980 V175A probably benign Het
Rassf7 C A 7: 141,217,060 probably null Het
Rbl2 A G 8: 91,078,932 I206V probably benign Het
Rnf111 A T 9: 70,459,096 H353Q probably benign Het
Rpn1 T G 6: 88,093,859 V237G probably damaging Het
Sec61a2 T A 2: 5,876,540 I267F possibly damaging Het
Spop G T 11: 95,485,843 V241F probably damaging Het
Sptbn2 C T 19: 4,725,950 A178V probably damaging Het
Stard13 A G 5: 151,045,901 Y791H probably benign Het
Susd2 T A 10: 75,642,218 I113L probably benign Het
Tcof1 T C 18: 60,831,556 E666G possibly damaging Het
Tekt5 G T 16: 10,361,390 A371E possibly damaging Het
Thap11 G A 8: 105,855,916 E186K probably damaging Het
Tk2 A T 8: 104,247,683 D45E possibly damaging Het
Tuba8 C A 6: 121,222,913 Y185* probably null Het
Usp24 T A 4: 106,416,047 Y2210N probably damaging Het
Wfdc8 A T 2: 164,597,319 probably benign Het
Zar1l T C 5: 150,512,900 N237S probably damaging Het
Zfp607b A T 7: 27,702,607 T163S probably benign Het
Zfp619 C A 7: 39,535,153 H202Q probably benign Het
Other mutations in Erich6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Erich6 APN 3 58637043 missense unknown
IGL01352:Erich6 APN 3 58622360 splice site probably null
IGL01362:Erich6 APN 3 58622360 splice site probably null
IGL01928:Erich6 APN 3 58621271 missense probably damaging 1.00
IGL02930:Erich6 APN 3 58622354 splice site probably benign
IGL03125:Erich6 APN 3 58624306 missense probably benign 0.00
PIT4243001:Erich6 UTSW 3 58629879 missense possibly damaging 0.51
R0081:Erich6 UTSW 3 58636126 splice site probably benign
R0129:Erich6 UTSW 3 58624378 missense probably damaging 1.00
R0308:Erich6 UTSW 3 58636104 missense probably damaging 1.00
R0682:Erich6 UTSW 3 58636811 missense probably benign 0.39
R0734:Erich6 UTSW 3 58629388 splice site probably benign
R0744:Erich6 UTSW 3 58636122 splice site probably benign
R0833:Erich6 UTSW 3 58618944 splice site probably benign
R0836:Erich6 UTSW 3 58618944 splice site probably benign
R1385:Erich6 UTSW 3 58636830 missense probably benign 0.00
R1536:Erich6 UTSW 3 58626598 missense probably benign 0.01
R1570:Erich6 UTSW 3 58630659 critical splice donor site probably null
R1708:Erich6 UTSW 3 58616447 missense probably benign 0.21
R2187:Erich6 UTSW 3 58629845 critical splice donor site probably null
R2268:Erich6 UTSW 3 58618839 missense probably benign 0.03
R2441:Erich6 UTSW 3 58618811 missense probably damaging 1.00
R3803:Erich6 UTSW 3 58621332 missense probably damaging 1.00
R3981:Erich6 UTSW 3 58636704 missense probably benign 0.41
R4166:Erich6 UTSW 3 58618808 missense probably damaging 1.00
R4298:Erich6 UTSW 3 58624291 missense probably benign 0.09
R4729:Erich6 UTSW 3 58636059 critical splice donor site probably null
R4838:Erich6 UTSW 3 58636830 missense probably benign 0.00
R5117:Erich6 UTSW 3 58623205 missense probably benign 0.00
R5305:Erich6 UTSW 3 58625116 missense probably benign 0.21
R5605:Erich6 UTSW 3 58625119 missense probably damaging 1.00
R6033:Erich6 UTSW 3 58623201 missense probably benign 0.16
R6033:Erich6 UTSW 3 58623201 missense probably benign 0.16
R6378:Erich6 UTSW 3 58622359 splice site probably null
R6606:Erich6 UTSW 3 58616500 missense probably damaging 1.00
R6736:Erich6 UTSW 3 58625054 missense probably damaging 1.00
R6746:Erich6 UTSW 3 58616566 missense possibly damaging 0.69
R6974:Erich6 UTSW 3 58618799 missense probably benign 0.06
R6996:Erich6 UTSW 3 58636095 missense probably damaging 1.00
R7317:Erich6 UTSW 3 58636884 missense probably benign 0.26
R7484:Erich6 UTSW 3 58626691 splice site probably null
R7526:Erich6 UTSW 3 58630689 missense probably damaging 1.00
R7747:Erich6 UTSW 3 58618928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAACGCTCATTGTGAATTC -3'
(R):5'- CACGACACCTTGGTCTATTAATGATC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- GTCTATTAATGATCATTCTGGTTGCC -3'
Posted On2016-10-24