Mutagenetix > Incidental Mutation

Incidental Mutation 'R5546:Polr1a'

436278

Institutional Source

Beutler Lab

Gene Symbol

Polr1a

Ensembl Gene

ENSMUSG00000049553

Gene Name

polymerase (RNA) I polypeptide A

Synonyms

RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4

MMRRC Submission

043104-MU

Accession Numbers

Genbank: NM_009088; MGI: 1096397

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5546 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

71909053-71984935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 71929366 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 389 (S389P)

Ref Sequence

ENSEMBL: ENSMUSP00000060858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]

AlphaFold

O35134

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055296
AA Change: S389P

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: S389P

Domain	Start	End	E-Value	Type
RPOLA_N	302	649	8.97e-137	SMART
Pfam:RNA_pol_Rpb1_4	846	958	1.3e-26	PFAM
Pfam:RNA_pol_Rpb1_5	965	1669	7e-103	PFAM
low complexity region	1698	1708	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205333

Predicted Effect

probably benign
Transcript: ENSMUST00000206556

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206753

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206823

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl11	A	G	9: 107,929,633	N385S	probably benign	Het
Ahctf1	A	T	1: 179,754,068	I1523N	probably benign	Het
Akna	C	T	4: 63,394,959	G309E	probably benign	Het
Akna	T	C	4: 63,395,566	N107D	probably benign	Het
Arhgef15	G	A	11: 68,954,051	P240L	probably benign	Het
Brd1	T	A	15: 88,701,122	E836D	probably benign	Het
Brf2	A	G	8: 27,124,283	S292P	possibly damaging	Het
C3	A	G	17: 57,222,976	L500P	probably damaging	Het
Ccdc107	T	C	4: 43,495,685	L196P	probably damaging	Het
Cdcp1	G	T	9: 123,178,029	P551Q	probably damaging	Het
Ckap5	T	C	2: 91,594,816	L1224P	probably damaging	Het
Csnk1g2	C	A	10: 80,638,398	T178K	probably benign	Het
Ctsq	A	T	13: 61,037,888	C146*	probably null	Het
Cyp2ab1	T	A	16: 20,313,757	I264F	probably damaging	Het
Daxx	TGATGATGACGATGATGACGATGATGA	TGATGATGACGATGATGA	17: 33,912,641		probably benign	Het
Dnah11	G	A	12: 117,975,848	T3179M	possibly damaging	Het
Dnah7c	A	T	1: 46,666,317	T2497S	probably damaging	Het
Eif4enif1	T	C	11: 3,243,989	V776A	probably damaging	Het
Erbb4	G	T	1: 68,298,293	T622N	probably damaging	Het
Erich6	A	G	3: 58,618,797	Y595H	probably benign	Het
Fam107a	C	T	14: 8,298,764	A121T	probably benign	Het
Gif	T	C	19: 11,748,495	S50P	possibly damaging	Het
Gpatch11	C	T	17: 78,842,119	Q183*	probably null	Het
Gpr161	C	A	1: 165,306,413	F81L	possibly damaging	Het
Hook1	G	T	4: 96,002,528	E291D	probably benign	Het
Hsf2bp	T	A	17: 31,946,695	I309F	probably damaging	Het
Hspg2	T	C	4: 137,548,174		probably null	Het
Ide	T	G	19: 37,272,224	M910L	unknown	Het
Igdcc4	A	G	9: 65,128,795	Y712C	probably damaging	Het
Kmt2d	T	C	15: 98,853,068		probably benign	Het
Lats1	T	C	10: 7,705,754	Y768H	probably damaging	Het
Mageb3	A	G	2: 121,954,387	V278A	probably damaging	Het
Mapkbp1	G	A	2: 120,019,243	R732H	probably damaging	Het
Marveld2	T	C	13: 100,600,938	I148V	probably benign	Het
Mast1	G	C	8: 84,916,260	P969A	probably damaging	Het
Myh10	T	G	11: 68,798,380	V1261G	possibly damaging	Het
Nlrp1b	A	T	11: 71,217,276	H466Q	probably benign	Het
Npr2	T	G	4: 43,650,150	V905G	probably damaging	Het
Oip5	T	A	2: 119,610,327	I240F	unknown	Het
Olfr1259	A	G	2: 89,943,585	C177R	probably damaging	Het
Olfr175-ps1	G	T	16: 58,824,153	Y185*	probably null	Het
Olfr874	T	A	9: 37,746,524	M130K	probably benign	Het
Pcsk2	G	A	2: 143,546,560	A24T	probably benign	Het
Plxnb1	G	T	9: 109,100,750	G225W	probably damaging	Het
Prkca	A	G	11: 108,053,980	V175A	probably benign	Het
Rassf7	C	A	7: 141,217,060		probably null	Het
Rbl2	A	G	8: 91,078,932	I206V	probably benign	Het
Rnf111	A	T	9: 70,459,096	H353Q	probably benign	Het
Rpn1	T	G	6: 88,093,859	V237G	probably damaging	Het
Sec61a2	T	A	2: 5,876,540	I267F	possibly damaging	Het
Spop	G	T	11: 95,485,843	V241F	probably damaging	Het
Sptbn2	C	T	19: 4,725,950	A178V	probably damaging	Het
Stard13	A	G	5: 151,045,901	Y791H	probably benign	Het
Susd2	T	A	10: 75,642,218	I113L	probably benign	Het
Tcof1	T	C	18: 60,831,556	E666G	possibly damaging	Het
Tekt5	G	T	16: 10,361,390	A371E	possibly damaging	Het
Thap11	G	A	8: 105,855,916	E186K	probably damaging	Het
Tk2	A	T	8: 104,247,683	D45E	possibly damaging	Het
Tuba8	C	A	6: 121,222,913	Y185*	probably null	Het
Usp24	T	A	4: 106,416,047	Y2210N	probably damaging	Het
Wfdc8	A	T	2: 164,597,319		probably benign	Het
Zar1l	T	C	5: 150,512,900	N237S	probably damaging	Het
Zfp607b	A	T	7: 27,702,607	T163S	probably benign	Het
Zfp619	C	A	7: 39,535,153	H202Q	probably benign	Het

Other mutations in Polr1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Polr1a	APN	6	71948486	missense	probably benign	0.32
IGL01834:Polr1a	APN	6	71948462	missense	probably benign
IGL01902:Polr1a	APN	6	71963748	missense	probably damaging	1.00
IGL02101:Polr1a	APN	6	71950802	missense	probably benign	0.00
IGL02325:Polr1a	APN	6	71920657	missense	probably benign	0.38
IGL02398:Polr1a	APN	6	71936556	splice site	probably benign
IGL02528:Polr1a	APN	6	71964717	missense	probably benign
IGL02555:Polr1a	APN	6	71920457	missense	probably damaging	0.98
IGL02613:Polr1a	APN	6	71967320	missense	probably damaging	1.00
IGL02693:Polr1a	APN	6	71963846	splice site	probably benign
IGL02892:Polr1a	APN	6	71931696	missense	possibly damaging	0.70
IGL03059:Polr1a	APN	6	71936512	missense	probably benign
IGL03174:Polr1a	APN	6	71977347	missense	possibly damaging	0.82
D4043:Polr1a	UTSW	6	71941417	missense	possibly damaging	0.92
R0092:Polr1a	UTSW	6	71967455	splice site	probably benign
R0217:Polr1a	UTSW	6	71963703	missense	probably benign	0.19
R0267:Polr1a	UTSW	6	71974139	missense	probably damaging	0.99
R0329:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0330:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0352:Polr1a	UTSW	6	71920763	splice site	probably benign
R0411:Polr1a	UTSW	6	71978421	missense	possibly damaging	0.95
R0446:Polr1a	UTSW	6	71950664	critical splice donor site	probably null
R0846:Polr1a	UTSW	6	71924643	missense	probably damaging	1.00
R1035:Polr1a	UTSW	6	71967916	missense	probably benign
R1294:Polr1a	UTSW	6	71912902	missense	probably damaging	0.99
R1460:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R1657:Polr1a	UTSW	6	71941535	missense	probably damaging	1.00
R1846:Polr1a	UTSW	6	71976188	missense	probably damaging	0.98
R1862:Polr1a	UTSW	6	71909203	missense	probably damaging	0.96
R1865:Polr1a	UTSW	6	71966524	missense	probably damaging	1.00
R1903:Polr1a	UTSW	6	71967914	missense	probably benign	0.02
R1937:Polr1a	UTSW	6	71936552	critical splice donor site	probably null
R2063:Polr1a	UTSW	6	71936285	splice site	probably null
R2071:Polr1a	UTSW	6	71976074	missense	possibly damaging	0.64
R2084:Polr1a	UTSW	6	71950809	missense	possibly damaging	0.69
R2377:Polr1a	UTSW	6	71972826	critical splice donor site	probably null
R2410:Polr1a	UTSW	6	71974882	missense	probably benign
R3001:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3001:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3924:Polr1a	UTSW	6	71929450	missense	probably benign	0.00
R4105:Polr1a	UTSW	6	71976191	missense	probably damaging	0.98
R4125:Polr1a	UTSW	6	71965706	missense	probably benign	0.00
R4271:Polr1a	UTSW	6	71953022	missense	probably benign	0.02
R4440:Polr1a	UTSW	6	71950848	missense	probably damaging	0.98
R4667:Polr1a	UTSW	6	71917821	missense	probably benign	0.30
R4769:Polr1a	UTSW	6	71950868	missense	probably benign	0.01
R4801:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4802:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4828:Polr1a	UTSW	6	71966401	missense	possibly damaging	0.93
R4911:Polr1a	UTSW	6	71909229	missense	possibly damaging	0.67
R5071:Polr1a	UTSW	6	71931709	missense	possibly damaging	0.71
R5165:Polr1a	UTSW	6	71967925	missense	probably damaging	1.00
R5223:Polr1a	UTSW	6	71967907	missense	possibly damaging	0.73
R5239:Polr1a	UTSW	6	71913037	missense	probably damaging	1.00
R5599:Polr1a	UTSW	6	71967362	missense	possibly damaging	0.95
R5696:Polr1a	UTSW	6	71929426	missense	probably benign	0.05
R5850:Polr1a	UTSW	6	71926683	missense	probably benign	0.00
R6274:Polr1a	UTSW	6	71954890	splice site	probably null
R6526:Polr1a	UTSW	6	71929443	missense	possibly damaging	0.89
R6578:Polr1a	UTSW	6	71976041	missense	possibly damaging	0.93
R6660:Polr1a	UTSW	6	71967374	missense	probably damaging	0.98
R6892:Polr1a	UTSW	6	71964712	missense	possibly damaging	0.72
R7274:Polr1a	UTSW	6	71920516	nonsense	probably null
R7291:Polr1a	UTSW	6	71941456	missense	probably benign	0.02
R7311:Polr1a	UTSW	6	71950879	missense	possibly damaging	0.53
R7431:Polr1a	UTSW	6	71926659	missense	probably benign	0.14
R7479:Polr1a	UTSW	6	71936297	missense	probably damaging	1.00
R7607:Polr1a	UTSW	6	71913021	missense	probably benign
R7739:Polr1a	UTSW	6	71954835	missense	possibly damaging	0.94
R7746:Polr1a	UTSW	6	71941512	missense	probably damaging	1.00
R7764:Polr1a	UTSW	6	71953070	missense	probably damaging	1.00
R7835:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R8029:Polr1a	UTSW	6	71912956	nonsense	probably null
R8057:Polr1a	UTSW	6	71931660	missense	possibly damaging	0.95
R8144:Polr1a	UTSW	6	71950616	missense	probably benign
R8170:Polr1a	UTSW	6	71920749	missense	probably benign
R8320:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R8328:Polr1a	UTSW	6	71920734	missense	probably benign
R8331:Polr1a	UTSW	6	71976179	missense	probably damaging	1.00
R8362:Polr1a	UTSW	6	71964667	missense	probably benign	0.00
R8511:Polr1a	UTSW	6	71920520	missense	probably benign	0.01
R8709:Polr1a	UTSW	6	71974848	missense	probably benign
R8745:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R8784:Polr1a	UTSW	6	71950628	missense	probably benign
R9055:Polr1a	UTSW	6	71915069	missense	possibly damaging	0.46
R9088:Polr1a	UTSW	6	71931783	missense	probably benign	0.26
R9211:Polr1a	UTSW	6	71966537	missense	probably damaging	1.00
R9228:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R9240:Polr1a	UTSW	6	71963677	nonsense	probably null
R9267:Polr1a	UTSW	6	71965558	missense	probably benign
R9302:Polr1a	UTSW	6	71924699	critical splice donor site	probably null
R9744:Polr1a	UTSW	6	71929388	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TACCATCTGTCAGCTTCCAGGG -3'
(R):5'- TGTTAGCTGCTGACCCTCAC -3'

Sequencing Primer
(F):5'- AGGGCATTGGATCCCATTAC -3'
(R):5'- TCACCAACATGTGATCGGAATC -3'

Posted On

2016-10-24