Mutagenetix > Incidental Mutation

Incidental Mutation 'R5546:Mast1'

436285

Institutional Source

Beutler Lab

Gene Symbol

Mast1

Ensembl Gene

ENSMUSG00000053693

Gene Name

microtubule associated serine/threonine kinase 1

Synonyms

SAST170, SAST, 9430008B02Rik

MMRRC Submission

043104-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5546 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84911903-84937359 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 84916260 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Alanine at position 969 (P969A)

Ref Sequence

ENSEMBL: ENSMUSP00000105363 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003910] [ENSMUST00000109741] [ENSMUST00000109744] [ENSMUST00000119820]

AlphaFold

Q9R1L5

Predicted Effect

probably benign
Transcript: ENSMUST00000003910

SMART Domains

Protein: ENSMUSP00000003910
Gene: ENSMUSG00000003812

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:DNase_II	21	349	5.8e-116	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109741
AA Change: P969A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693
AA Change: P969A

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	337	1.4e-136	PFAM
S_TKc	376	649	4.07e-97	SMART
S_TK_X	650	710	6.23e-2	SMART
low complexity region	820	836	N/A	INTRINSIC
low complexity region	863	878	N/A	INTRINSIC
low complexity region	933	961	N/A	INTRINSIC
PDZ	977	1057	3.49e-14	SMART
low complexity region	1104	1132	N/A	INTRINSIC
low complexity region	1149	1174	N/A	INTRINSIC
low complexity region	1212	1224	N/A	INTRINSIC
low complexity region	1243	1252	N/A	INTRINSIC
low complexity region	1479	1492	N/A	INTRINSIC
low complexity region	1519	1535	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109744

SMART Domains

Protein: ENSMUSP00000105366
Gene: ENSMUSG00000003812

Domain	Start	End	E-Value	Type
Pfam:DNase_II	9	328	4.8e-114	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000119820

SMART Domains

Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	338	5.1e-148	PFAM
S_TKc	376	644	2.79e-86	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128400

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135219

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153000

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl11	A	G	9: 107,929,633	N385S	probably benign	Het
Ahctf1	A	T	1: 179,754,068	I1523N	probably benign	Het
Akna	C	T	4: 63,394,959	G309E	probably benign	Het
Akna	T	C	4: 63,395,566	N107D	probably benign	Het
Arhgef15	G	A	11: 68,954,051	P240L	probably benign	Het
Brd1	T	A	15: 88,701,122	E836D	probably benign	Het
Brf2	A	G	8: 27,124,283	S292P	possibly damaging	Het
C3	A	G	17: 57,222,976	L500P	probably damaging	Het
Ccdc107	T	C	4: 43,495,685	L196P	probably damaging	Het
Cdcp1	G	T	9: 123,178,029	P551Q	probably damaging	Het
Ckap5	T	C	2: 91,594,816	L1224P	probably damaging	Het
Csnk1g2	C	A	10: 80,638,398	T178K	probably benign	Het
Ctsq	A	T	13: 61,037,888	C146*	probably null	Het
Cyp2ab1	T	A	16: 20,313,757	I264F	probably damaging	Het
Daxx	TGATGATGACGATGATGACGATGATGA	TGATGATGACGATGATGA	17: 33,912,641		probably benign	Het
Dnah11	G	A	12: 117,975,848	T3179M	possibly damaging	Het
Dnah7c	A	T	1: 46,666,317	T2497S	probably damaging	Het
Eif4enif1	T	C	11: 3,243,989	V776A	probably damaging	Het
Erbb4	G	T	1: 68,298,293	T622N	probably damaging	Het
Erich6	A	G	3: 58,618,797	Y595H	probably benign	Het
Fam107a	C	T	14: 8,298,764	A121T	probably benign	Het
Gif	T	C	19: 11,748,495	S50P	possibly damaging	Het
Gpatch11	C	T	17: 78,842,119	Q183*	probably null	Het
Gpr161	C	A	1: 165,306,413	F81L	possibly damaging	Het
Hook1	G	T	4: 96,002,528	E291D	probably benign	Het
Hsf2bp	T	A	17: 31,946,695	I309F	probably damaging	Het
Hspg2	T	C	4: 137,548,174		probably null	Het
Ide	T	G	19: 37,272,224	M910L	unknown	Het
Igdcc4	A	G	9: 65,128,795	Y712C	probably damaging	Het
Kmt2d	T	C	15: 98,853,068		probably benign	Het
Lats1	T	C	10: 7,705,754	Y768H	probably damaging	Het
Mageb3	A	G	2: 121,954,387	V278A	probably damaging	Het
Mapkbp1	G	A	2: 120,019,243	R732H	probably damaging	Het
Marveld2	T	C	13: 100,600,938	I148V	probably benign	Het
Myh10	T	G	11: 68,798,380	V1261G	possibly damaging	Het
Nlrp1b	A	T	11: 71,217,276	H466Q	probably benign	Het
Npr2	T	G	4: 43,650,150	V905G	probably damaging	Het
Oip5	T	A	2: 119,610,327	I240F	unknown	Het
Olfr1259	A	G	2: 89,943,585	C177R	probably damaging	Het
Olfr175-ps1	G	T	16: 58,824,153	Y185*	probably null	Het
Olfr874	T	A	9: 37,746,524	M130K	probably benign	Het
Pcsk2	G	A	2: 143,546,560	A24T	probably benign	Het
Plxnb1	G	T	9: 109,100,750	G225W	probably damaging	Het
Polr1a	T	C	6: 71,929,366	S389P	possibly damaging	Het
Prkca	A	G	11: 108,053,980	V175A	probably benign	Het
Rassf7	C	A	7: 141,217,060		probably null	Het
Rbl2	A	G	8: 91,078,932	I206V	probably benign	Het
Rnf111	A	T	9: 70,459,096	H353Q	probably benign	Het
Rpn1	T	G	6: 88,093,859	V237G	probably damaging	Het
Sec61a2	T	A	2: 5,876,540	I267F	possibly damaging	Het
Spop	G	T	11: 95,485,843	V241F	probably damaging	Het
Sptbn2	C	T	19: 4,725,950	A178V	probably damaging	Het
Stard13	A	G	5: 151,045,901	Y791H	probably benign	Het
Susd2	T	A	10: 75,642,218	I113L	probably benign	Het
Tcof1	T	C	18: 60,831,556	E666G	possibly damaging	Het
Tekt5	G	T	16: 10,361,390	A371E	possibly damaging	Het
Thap11	G	A	8: 105,855,916	E186K	probably damaging	Het
Tk2	A	T	8: 104,247,683	D45E	possibly damaging	Het
Tuba8	C	A	6: 121,222,913	Y185*	probably null	Het
Usp24	T	A	4: 106,416,047	Y2210N	probably damaging	Het
Wfdc8	A	T	2: 164,597,319		probably benign	Het
Zar1l	T	C	5: 150,512,900	N237S	probably damaging	Het
Zfp607b	A	T	7: 27,702,607	T163S	probably benign	Het
Zfp619	C	A	7: 39,535,153	H202Q	probably benign	Het

Other mutations in Mast1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01395:Mast1	APN	8	84912815	missense	possibly damaging	0.87
IGL01862:Mast1	APN	8	84913246	splice site	probably null
IGL01918:Mast1	APN	8	84921209	missense	probably damaging	1.00
IGL02212:Mast1	APN	8	84921397	missense	probably damaging	1.00
IGL02221:Mast1	APN	8	84918755	missense	possibly damaging	0.92
IGL02370:Mast1	APN	8	84912254	missense	probably benign
IGL02470:Mast1	APN	8	84921212	missense	probably damaging	1.00
IGL02596:Mast1	APN	8	84917771	missense	probably benign
IGL02716:Mast1	APN	8	84935723	missense	probably damaging	1.00
IGL02987:Mast1	APN	8	84925719	missense	possibly damaging	0.75
IGL03287:Mast1	APN	8	84913353	missense	probably benign	0.01
R0255:Mast1	UTSW	8	84912021	missense	probably benign
R0388:Mast1	UTSW	8	84915537	missense	probably benign	0.13
R0480:Mast1	UTSW	8	84913089	missense	probably damaging	0.99
R0727:Mast1	UTSW	8	84921415	missense	probably damaging	1.00
R1175:Mast1	UTSW	8	84925327	missense	probably benign	0.29
R1297:Mast1	UTSW	8	84912716	missense	probably benign	0.05
R1328:Mast1	UTSW	8	84917988	intron	probably benign
R1454:Mast1	UTSW	8	84920635	missense	probably damaging	1.00
R1532:Mast1	UTSW	8	84928609	nonsense	probably null
R1752:Mast1	UTSW	8	84925336	missense	probably benign
R1777:Mast1	UTSW	8	84912068	missense	probably benign
R1905:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R1906:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R1907:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R2056:Mast1	UTSW	8	84920366	missense	possibly damaging	0.95
R2071:Mast1	UTSW	8	84921194	missense	probably damaging	1.00
R2145:Mast1	UTSW	8	84921478	missense	probably damaging	1.00
R2318:Mast1	UTSW	8	84921125	missense	probably damaging	1.00
R2842:Mast1	UTSW	8	84923908	missense	probably damaging	1.00
R3870:Mast1	UTSW	8	84918731	missense	probably damaging	1.00
R3895:Mast1	UTSW	8	84935723	missense	probably damaging	1.00
R3973:Mast1	UTSW	8	84918764	missense	probably damaging	1.00
R4405:Mast1	UTSW	8	84920891	missense	probably damaging	1.00
R4533:Mast1	UTSW	8	84921361	missense	probably damaging	1.00
R4725:Mast1	UTSW	8	84929006	missense	possibly damaging	0.93
R4770:Mast1	UTSW	8	84929246	missense	probably benign	0.02
R4776:Mast1	UTSW	8	84937193	critical splice donor site	probably null
R4835:Mast1	UTSW	8	84923779	missense	probably damaging	1.00
R4871:Mast1	UTSW	8	84920658	missense	probably damaging	1.00
R4953:Mast1	UTSW	8	84918728	missense	probably damaging	0.99
R4960:Mast1	UTSW	8	84917871	missense	probably benign
R4978:Mast1	UTSW	8	84935787	missense	probably damaging	0.98
R5164:Mast1	UTSW	8	84913518	unclassified	probably benign
R5235:Mast1	UTSW	8	84913439	missense	probably damaging	1.00
R5297:Mast1	UTSW	8	84913318	critical splice donor site	probably null
R5463:Mast1	UTSW	8	84925507	missense	probably damaging	1.00
R5651:Mast1	UTSW	8	84928968	nonsense	probably null
R6124:Mast1	UTSW	8	84925307	missense	probably benign	0.01
R6213:Mast1	UTSW	8	84915569	missense	probably damaging	1.00
R6717:Mast1	UTSW	8	84917754	missense	probably benign
R7000:Mast1	UTSW	8	84928969	missense	probably damaging	1.00
R7011:Mast1	UTSW	8	84911945	nonsense	probably null
R7164:Mast1	UTSW	8	84935304	missense	possibly damaging	0.81
R7695:Mast1	UTSW	8	84920928	missense	probably damaging	1.00
R7845:Mast1	UTSW	8	84925325	nonsense	probably null
R7882:Mast1	UTSW	8	84913318	critical splice donor site	probably null
R8167:Mast1	UTSW	8	84921358	missense	probably damaging	1.00
R8197:Mast1	UTSW	8	84912821	missense	possibly damaging	0.90
R8773:Mast1	UTSW	8	84916324	missense	probably damaging	1.00
R9477:Mast1	UTSW	8	84912150	missense	probably benign	0.18
R9526:Mast1	UTSW	8	84921176	missense	probably damaging	1.00
R9557:Mast1	UTSW	8	84930845	missense	probably damaging	1.00
R9655:Mast1	UTSW	8	84924031	missense	probably damaging	1.00
X0066:Mast1	UTSW	8	84920878	missense	probably damaging	1.00
Z1176:Mast1	UTSW	8	84912459	missense	probably damaging	0.97
Z1176:Mast1	UTSW	8	84918681	missense	probably damaging	1.00
Z1177:Mast1	UTSW	8	84920446	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- CGCCCATTGGTAGAAGAAGC -3'
(R):5'- AGGTTTGCCCTGATCTCTAAC -3'

Sequencing Primer
(F):5'- TTGGTAGAAGAAGCTACTTATGGCCC -3'
(R):5'- GCCCTGATCTCTAACCATCATGG -3'

Posted On

2016-10-24