Incidental Mutation 'R5546:Olfr874'
ID436289
Institutional Source Beutler Lab
Gene Symbol Olfr874
Ensembl Gene ENSMUSG00000063350
Gene Nameolfactory receptor 874
SynonymsMOR161-2, GA_x6K02T2PVTD-31428850-31429782
MMRRC Submission 043104-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5546 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location37745106-37748594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37746524 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 130 (M130K)
Ref Sequence ENSEMBL: ENSMUSP00000150088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115004] [ENSMUST00000216982]
Predicted Effect probably benign
Transcript: ENSMUST00000115004
AA Change: M130K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110656
Gene: ENSMUSG00000063350
AA Change: M130K

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 5.9e-49 PFAM
Pfam:7tm_1 40 289 6.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216982
AA Change: M130K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,929,633 N385S probably benign Het
Ahctf1 A T 1: 179,754,068 I1523N probably benign Het
Akna C T 4: 63,394,959 G309E probably benign Het
Akna T C 4: 63,395,566 N107D probably benign Het
Arhgef15 G A 11: 68,954,051 P240L probably benign Het
Brd1 T A 15: 88,701,122 E836D probably benign Het
Brf2 A G 8: 27,124,283 S292P possibly damaging Het
C3 A G 17: 57,222,976 L500P probably damaging Het
Ccdc107 T C 4: 43,495,685 L196P probably damaging Het
Cdcp1 G T 9: 123,178,029 P551Q probably damaging Het
Ckap5 T C 2: 91,594,816 L1224P probably damaging Het
Csnk1g2 C A 10: 80,638,398 T178K probably benign Het
Ctsq A T 13: 61,037,888 C146* probably null Het
Cyp2ab1 T A 16: 20,313,757 I264F probably damaging Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 33,912,641 probably benign Het
Dnah11 G A 12: 117,975,848 T3179M possibly damaging Het
Dnah7c A T 1: 46,666,317 T2497S probably damaging Het
Eif4enif1 T C 11: 3,243,989 V776A probably damaging Het
Erbb4 G T 1: 68,298,293 T622N probably damaging Het
Erich6 A G 3: 58,618,797 Y595H probably benign Het
Fam107a C T 14: 8,298,764 A121T probably benign Het
Gif T C 19: 11,748,495 S50P possibly damaging Het
Gpatch11 C T 17: 78,842,119 Q183* probably null Het
Gpr161 C A 1: 165,306,413 F81L possibly damaging Het
Hook1 G T 4: 96,002,528 E291D probably benign Het
Hsf2bp T A 17: 31,946,695 I309F probably damaging Het
Hspg2 T C 4: 137,548,174 probably null Het
Ide T G 19: 37,272,224 M910L unknown Het
Igdcc4 A G 9: 65,128,795 Y712C probably damaging Het
Kmt2d T C 15: 98,853,068 probably benign Het
Lats1 T C 10: 7,705,754 Y768H probably damaging Het
Mageb3 A G 2: 121,954,387 V278A probably damaging Het
Mapkbp1 G A 2: 120,019,243 R732H probably damaging Het
Marveld2 T C 13: 100,600,938 I148V probably benign Het
Mast1 G C 8: 84,916,260 P969A probably damaging Het
Myh10 T G 11: 68,798,380 V1261G possibly damaging Het
Nlrp1b A T 11: 71,217,276 H466Q probably benign Het
Npr2 T G 4: 43,650,150 V905G probably damaging Het
Oip5 T A 2: 119,610,327 I240F unknown Het
Olfr1259 A G 2: 89,943,585 C177R probably damaging Het
Olfr175-ps1 G T 16: 58,824,153 Y185* probably null Het
Pcsk2 G A 2: 143,546,560 A24T probably benign Het
Plxnb1 G T 9: 109,100,750 G225W probably damaging Het
Polr1a T C 6: 71,929,366 S389P possibly damaging Het
Prkca A G 11: 108,053,980 V175A probably benign Het
Rassf7 C A 7: 141,217,060 probably null Het
Rbl2 A G 8: 91,078,932 I206V probably benign Het
Rnf111 A T 9: 70,459,096 H353Q probably benign Het
Rpn1 T G 6: 88,093,859 V237G probably damaging Het
Sec61a2 T A 2: 5,876,540 I267F possibly damaging Het
Spop G T 11: 95,485,843 V241F probably damaging Het
Sptbn2 C T 19: 4,725,950 A178V probably damaging Het
Stard13 A G 5: 151,045,901 Y791H probably benign Het
Susd2 T A 10: 75,642,218 I113L probably benign Het
Tcof1 T C 18: 60,831,556 E666G possibly damaging Het
Tekt5 G T 16: 10,361,390 A371E possibly damaging Het
Thap11 G A 8: 105,855,916 E186K probably damaging Het
Tk2 A T 8: 104,247,683 D45E possibly damaging Het
Tuba8 C A 6: 121,222,913 Y185* probably null Het
Usp24 T A 4: 106,416,047 Y2210N probably damaging Het
Wfdc8 A T 2: 164,597,319 probably benign Het
Zar1l T C 5: 150,512,900 N237S probably damaging Het
Zfp607b A T 7: 27,702,607 T163S probably benign Het
Zfp619 C A 7: 39,535,153 H202Q probably benign Het
Other mutations in Olfr874
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Olfr874 APN 9 37746389 missense possibly damaging 0.89
IGL02349:Olfr874 APN 9 37746206 missense probably benign 0.03
IGL02799:Olfr874 UTSW 9 37746509 missense probably damaging 1.00
R0498:Olfr874 UTSW 9 37746254 missense probably damaging 1.00
R0690:Olfr874 UTSW 9 37746217 missense probably benign 0.01
R1053:Olfr874 UTSW 9 37746835 missense probably damaging 0.99
R1777:Olfr874 UTSW 9 37746311 missense possibly damaging 0.78
R1862:Olfr874 UTSW 9 37746968 missense probably benign
R1907:Olfr874 UTSW 9 37746433 missense probably benign 0.35
R4524:Olfr874 UTSW 9 37746866 missense possibly damaging 0.50
R4731:Olfr874 UTSW 9 37746535 missense probably benign 0.06
R4746:Olfr874 UTSW 9 37746157 missense probably benign 0.02
R4768:Olfr874 UTSW 9 37746881 missense probably damaging 1.00
R5130:Olfr874 UTSW 9 37746509 missense probably damaging 1.00
R5406:Olfr874 UTSW 9 37746647 missense probably benign 0.23
R5882:Olfr874 UTSW 9 37746632 missense probably benign 0.02
R5946:Olfr874 UTSW 9 37747034 missense probably damaging 0.99
R6226:Olfr874 UTSW 9 37746137 start codon destroyed probably null 1.00
R6705:Olfr874 UTSW 9 37746734 missense possibly damaging 0.94
R6965:Olfr874 UTSW 9 37746137 start codon destroyed probably null 1.00
R8008:Olfr874 UTSW 9 37746793 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATTGGGCTGAACTCTCACC -3'
(R):5'- GCTATTGCAAGAGAGCTCAAG -3'

Sequencing Primer
(F):5'- GGGCTGAACTCTCACCTTCATAC -3'
(R):5'- CTCAAGAAGGGGAAGAATATCACAC -3'
Posted On2016-10-24