Incidental Mutation 'R5546:Lats1'
ID 436296
Institutional Source Beutler Lab
Gene Symbol Lats1
Ensembl Gene ENSMUSG00000040021
Gene Name large tumor suppressor
Synonyms
MMRRC Submission 043104-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.822) question?
Stock # R5546 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 7556978-7592224 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7581518 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 768 (Y768H)
Ref Sequence ENSEMBL: ENSMUSP00000151533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]
AlphaFold Q8BYR2
Predicted Effect probably damaging
Transcript: ENSMUST00000040043
AA Change: Y768H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: Y768H

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165952
AA Change: Y768H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: Y768H

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217931
AA Change: Y768H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,806,832 (GRCm39) N385S probably benign Het
Ahctf1 A T 1: 179,581,633 (GRCm39) I1523N probably benign Het
Akna C T 4: 63,313,196 (GRCm39) G309E probably benign Het
Akna T C 4: 63,313,803 (GRCm39) N107D probably benign Het
Arhgef15 G A 11: 68,844,877 (GRCm39) P240L probably benign Het
Brd1 T A 15: 88,585,325 (GRCm39) E836D probably benign Het
Brf2 A G 8: 27,614,311 (GRCm39) S292P possibly damaging Het
C3 A G 17: 57,529,976 (GRCm39) L500P probably damaging Het
Cblif T C 19: 11,725,859 (GRCm39) S50P possibly damaging Het
Ccdc107 T C 4: 43,495,685 (GRCm39) L196P probably damaging Het
Cdcp1 G T 9: 123,007,094 (GRCm39) P551Q probably damaging Het
Ckap5 T C 2: 91,425,161 (GRCm39) L1224P probably damaging Het
Csnk1g2 C A 10: 80,474,232 (GRCm39) T178K probably benign Het
Ctsq A T 13: 61,185,702 (GRCm39) C146* probably null Het
Cyp2ab1 T A 16: 20,132,507 (GRCm39) I264F probably damaging Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 34,131,615 (GRCm39) probably benign Het
Dnah11 G A 12: 117,939,583 (GRCm39) T3179M possibly damaging Het
Dnah7c A T 1: 46,705,477 (GRCm39) T2497S probably damaging Het
Eif4enif1 T C 11: 3,193,989 (GRCm39) V776A probably damaging Het
Erbb4 G T 1: 68,337,452 (GRCm39) T622N probably damaging Het
Erich6 A G 3: 58,526,218 (GRCm39) Y595H probably benign Het
Fam107a C T 14: 8,298,764 (GRCm38) A121T probably benign Het
Gpatch11 C T 17: 79,149,548 (GRCm39) Q183* probably null Het
Gpr161 C A 1: 165,133,982 (GRCm39) F81L possibly damaging Het
Hook1 G T 4: 95,890,765 (GRCm39) E291D probably benign Het
Hsf2bp T A 17: 32,165,669 (GRCm39) I309F probably damaging Het
Hspg2 T C 4: 137,275,485 (GRCm39) probably null Het
Ide T G 19: 37,249,623 (GRCm39) M910L unknown Het
Igdcc4 A G 9: 65,036,077 (GRCm39) Y712C probably damaging Het
Kmt2d T C 15: 98,750,949 (GRCm39) probably benign Het
Mageb3 A G 2: 121,784,868 (GRCm39) V278A probably damaging Het
Mapkbp1 G A 2: 119,849,724 (GRCm39) R732H probably damaging Het
Marveld2 T C 13: 100,737,446 (GRCm39) I148V probably benign Het
Mast1 G C 8: 85,642,889 (GRCm39) P969A probably damaging Het
Myh10 T G 11: 68,689,206 (GRCm39) V1261G possibly damaging Het
Nlrp1b A T 11: 71,108,102 (GRCm39) H466Q probably benign Het
Npr2 T G 4: 43,650,150 (GRCm39) V905G probably damaging Het
Oip5 T A 2: 119,440,808 (GRCm39) I240F unknown Het
Or4c12 A G 2: 89,773,929 (GRCm39) C177R probably damaging Het
Or5k8 G T 16: 58,644,516 (GRCm39) Y185* probably null Het
Or8b12 T A 9: 37,657,820 (GRCm39) M130K probably benign Het
Pcsk2 G A 2: 143,388,480 (GRCm39) A24T probably benign Het
Plxnb1 G T 9: 108,929,818 (GRCm39) G225W probably damaging Het
Polr1a T C 6: 71,906,350 (GRCm39) S389P possibly damaging Het
Prkca A G 11: 107,944,806 (GRCm39) V175A probably benign Het
Rassf7 C A 7: 140,796,973 (GRCm39) probably null Het
Rbl2 A G 8: 91,805,560 (GRCm39) I206V probably benign Het
Rnf111 A T 9: 70,366,378 (GRCm39) H353Q probably benign Het
Rpn1 T G 6: 88,070,841 (GRCm39) V237G probably damaging Het
Sec61a2 T A 2: 5,881,351 (GRCm39) I267F possibly damaging Het
Spop G T 11: 95,376,669 (GRCm39) V241F probably damaging Het
Sptbn2 C T 19: 4,775,978 (GRCm39) A178V probably damaging Het
Stard13 A G 5: 150,969,366 (GRCm39) Y791H probably benign Het
Susd2 T A 10: 75,478,052 (GRCm39) I113L probably benign Het
Tcof1 T C 18: 60,964,628 (GRCm39) E666G possibly damaging Het
Tekt5 G T 16: 10,179,254 (GRCm39) A371E possibly damaging Het
Thap11 G A 8: 106,582,548 (GRCm39) E186K probably damaging Het
Tk2 A T 8: 104,974,315 (GRCm39) D45E possibly damaging Het
Tuba8 C A 6: 121,199,872 (GRCm39) Y185* probably null Het
Usp24 T A 4: 106,273,244 (GRCm39) Y2210N probably damaging Het
Wfdc8 A T 2: 164,439,239 (GRCm39) probably benign Het
Zar1l T C 5: 150,436,365 (GRCm39) N237S probably damaging Het
Zfp607b A T 7: 27,402,032 (GRCm39) T163S probably benign Het
Zfp619 C A 7: 39,184,577 (GRCm39) H202Q probably benign Het
Other mutations in Lats1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Lats1 APN 10 7,567,330 (GRCm39) missense probably damaging 0.99
IGL00595:Lats1 APN 10 7,578,069 (GRCm39) missense probably benign 0.00
IGL00932:Lats1 APN 10 7,588,506 (GRCm39) missense possibly damaging 0.69
IGL01019:Lats1 APN 10 7,581,435 (GRCm39) missense probably damaging 1.00
IGL01380:Lats1 APN 10 7,567,544 (GRCm39) missense possibly damaging 0.69
IGL01965:Lats1 APN 10 7,577,470 (GRCm39) missense probably benign 0.10
IGL02027:Lats1 APN 10 7,588,712 (GRCm39) missense probably benign
IGL02611:Lats1 APN 10 7,581,551 (GRCm39) missense possibly damaging 0.91
IGL02997:Lats1 APN 10 7,578,018 (GRCm39) missense possibly damaging 0.53
IGL03107:Lats1 APN 10 7,588,510 (GRCm39) missense probably benign 0.15
I1329:Lats1 UTSW 10 7,588,566 (GRCm39) missense probably benign 0.10
PIT4378001:Lats1 UTSW 10 7,581,369 (GRCm39) missense probably damaging 1.00
R0153:Lats1 UTSW 10 7,567,339 (GRCm39) missense probably damaging 1.00
R0568:Lats1 UTSW 10 7,588,292 (GRCm39) missense possibly damaging 0.69
R0581:Lats1 UTSW 10 7,578,705 (GRCm39) missense possibly damaging 0.67
R0604:Lats1 UTSW 10 7,588,425 (GRCm39) missense probably damaging 0.96
R1681:Lats1 UTSW 10 7,581,678 (GRCm39) missense probably damaging 0.99
R1694:Lats1 UTSW 10 7,577,709 (GRCm39) missense probably benign 0.07
R1840:Lats1 UTSW 10 7,586,703 (GRCm39) nonsense probably null
R1914:Lats1 UTSW 10 7,586,221 (GRCm39) splice site probably benign
R2137:Lats1 UTSW 10 7,577,611 (GRCm39) missense possibly damaging 0.71
R2317:Lats1 UTSW 10 7,567,540 (GRCm39) nonsense probably null
R3863:Lats1 UTSW 10 7,581,510 (GRCm39) missense probably damaging 1.00
R3864:Lats1 UTSW 10 7,581,510 (GRCm39) missense probably damaging 1.00
R4597:Lats1 UTSW 10 7,567,510 (GRCm39) missense probably benign 0.00
R4657:Lats1 UTSW 10 7,581,448 (GRCm39) missense possibly damaging 0.82
R4658:Lats1 UTSW 10 7,578,493 (GRCm39) missense probably benign
R4663:Lats1 UTSW 10 7,588,347 (GRCm39) missense probably damaging 1.00
R4870:Lats1 UTSW 10 7,581,549 (GRCm39) missense probably damaging 1.00
R5101:Lats1 UTSW 10 7,588,348 (GRCm39) nonsense probably null
R5134:Lats1 UTSW 10 7,567,575 (GRCm39) missense probably benign 0.34
R5150:Lats1 UTSW 10 7,588,415 (GRCm39) missense probably benign
R5820:Lats1 UTSW 10 7,581,672 (GRCm39) missense probably damaging 1.00
R6006:Lats1 UTSW 10 7,581,359 (GRCm39) missense probably damaging 1.00
R6301:Lats1 UTSW 10 7,578,871 (GRCm39) missense probably benign 0.01
R6544:Lats1 UTSW 10 7,577,434 (GRCm39) missense possibly damaging 0.94
R6647:Lats1 UTSW 10 7,573,271 (GRCm39) missense possibly damaging 0.81
R6874:Lats1 UTSW 10 7,586,615 (GRCm39) missense probably damaging 1.00
R7328:Lats1 UTSW 10 7,581,311 (GRCm39) missense possibly damaging 0.62
R7390:Lats1 UTSW 10 7,577,859 (GRCm39) nonsense probably null
R7438:Lats1 UTSW 10 7,588,706 (GRCm39) nonsense probably null
R7457:Lats1 UTSW 10 7,586,655 (GRCm39) missense probably damaging 1.00
R7524:Lats1 UTSW 10 7,577,742 (GRCm39) missense possibly damaging 0.89
R7593:Lats1 UTSW 10 7,577,476 (GRCm39) missense probably damaging 1.00
R7736:Lats1 UTSW 10 7,578,128 (GRCm39) missense probably damaging 1.00
R7884:Lats1 UTSW 10 7,573,290 (GRCm39) nonsense probably null
R8166:Lats1 UTSW 10 7,577,880 (GRCm39) missense probably benign
R8248:Lats1 UTSW 10 7,581,667 (GRCm39) missense probably damaging 1.00
R8458:Lats1 UTSW 10 7,586,688 (GRCm39) nonsense probably null
R8477:Lats1 UTSW 10 7,581,279 (GRCm39) missense probably damaging 1.00
R8547:Lats1 UTSW 10 7,588,613 (GRCm39) missense probably damaging 1.00
R9163:Lats1 UTSW 10 7,578,052 (GRCm39) missense probably benign
R9441:Lats1 UTSW 10 7,578,681 (GRCm39) missense probably damaging 0.96
R9673:Lats1 UTSW 10 7,588,387 (GRCm39) missense probably benign 0.29
RF021:Lats1 UTSW 10 7,586,372 (GRCm39) missense probably damaging 1.00
X0026:Lats1 UTSW 10 7,586,387 (GRCm39) missense probably damaging 1.00
X0053:Lats1 UTSW 10 7,567,373 (GRCm39) missense probably benign 0.00
Z1176:Lats1 UTSW 10 7,581,573 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTAGGAATAGGAGCGTTTGGTG -3'
(R):5'- GTGCACAAGCCAAAGTCAGTC -3'

Sequencing Primer
(F):5'- TGAAGTCTGTCTAGCAAGAAAAGTC -3'
(R):5'- GTCAATTTAATATGGCCATCACGGTC -3'
Posted On 2016-10-24