Mutagenetix > Incidental Mutation

Incidental Mutation 'R5546:Susd2'

436297

Institutional Source

Beutler Lab

Gene Symbol

Susd2

Ensembl Gene

ENSMUSG00000006342

Gene Name

sushi domain containing 2

Synonyms

1200011D11Rik

MMRRC Submission

043104-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R5546 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75636706-75644008 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 75642218 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 113 (I113L)

Ref Sequence

ENSEMBL: ENSMUSP00000093197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001712] [ENSMUST00000077610] [ENSMUST00000095541]

AlphaFold

Q9DBX3

Predicted Effect

probably benign
Transcript: ENSMUST00000001712

SMART Domains

Protein: ENSMUSP00000001712
Gene: ENSMUSG00000020196

Domain	Start	End	E-Value	Type
low complexity region	61	71	N/A	INTRINSIC
TPR	90	123	4.15e-2	SMART
TPR	124	157	5.69e0	SMART
low complexity region	312	326	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
TPR	615	648	9.7e0	SMART
low complexity region	740	750	N/A	INTRINSIC
low complexity region	882	892	N/A	INTRINSIC
TPR	1055	1088	6.92e1	SMART
low complexity region	1327	1349	N/A	INTRINSIC
low complexity region	1714	1727	N/A	INTRINSIC
low complexity region	1778	1790	N/A	INTRINSIC
low complexity region	1791	1803	N/A	INTRINSIC
low complexity region	1810	1831	N/A	INTRINSIC
low complexity region	1941	1956	N/A	INTRINSIC
Pfam:MEF2_binding	2123	2157	5.7e-26	PFAM
low complexity region	2165	2183	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000077610

SMART Domains

Protein: ENSMUSP00000076802
Gene: ENSMUSG00000006342

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
AMOP	162	310	4.09e-82	SMART
VWD	313	489	1.9e-19	SMART
CCP	602	655	3.37e-17	SMART
transmembrane domain	663	685	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000095541
AA Change: I113L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000093197
Gene: ENSMUSG00000006342
AA Change: I113L

Domain	Start	End	E-Value	Type
SO	25	64	4.77e-2	SMART
AMOP	282	430	4.09e-82	SMART
VWD	433	609	1.9e-19	SMART
CCP	722	775	3.37e-17	SMART
transmembrane domain	783	805	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218896

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219733

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl11	A	G	9: 107,929,633	N385S	probably benign	Het
Ahctf1	A	T	1: 179,754,068	I1523N	probably benign	Het
Akna	C	T	4: 63,394,959	G309E	probably benign	Het
Akna	T	C	4: 63,395,566	N107D	probably benign	Het
Arhgef15	G	A	11: 68,954,051	P240L	probably benign	Het
Brd1	T	A	15: 88,701,122	E836D	probably benign	Het
Brf2	A	G	8: 27,124,283	S292P	possibly damaging	Het
C3	A	G	17: 57,222,976	L500P	probably damaging	Het
Ccdc107	T	C	4: 43,495,685	L196P	probably damaging	Het
Cdcp1	G	T	9: 123,178,029	P551Q	probably damaging	Het
Ckap5	T	C	2: 91,594,816	L1224P	probably damaging	Het
Csnk1g2	C	A	10: 80,638,398	T178K	probably benign	Het
Ctsq	A	T	13: 61,037,888	C146*	probably null	Het
Cyp2ab1	T	A	16: 20,313,757	I264F	probably damaging	Het
Daxx	TGATGATGACGATGATGACGATGATGA	TGATGATGACGATGATGA	17: 33,912,641		probably benign	Het
Dnah11	G	A	12: 117,975,848	T3179M	possibly damaging	Het
Dnah7c	A	T	1: 46,666,317	T2497S	probably damaging	Het
Eif4enif1	T	C	11: 3,243,989	V776A	probably damaging	Het
Erbb4	G	T	1: 68,298,293	T622N	probably damaging	Het
Erich6	A	G	3: 58,618,797	Y595H	probably benign	Het
Fam107a	C	T	14: 8,298,764	A121T	probably benign	Het
Gif	T	C	19: 11,748,495	S50P	possibly damaging	Het
Gpatch11	C	T	17: 78,842,119	Q183*	probably null	Het
Gpr161	C	A	1: 165,306,413	F81L	possibly damaging	Het
Hook1	G	T	4: 96,002,528	E291D	probably benign	Het
Hsf2bp	T	A	17: 31,946,695	I309F	probably damaging	Het
Hspg2	T	C	4: 137,548,174		probably null	Het
Ide	T	G	19: 37,272,224	M910L	unknown	Het
Igdcc4	A	G	9: 65,128,795	Y712C	probably damaging	Het
Kmt2d	T	C	15: 98,853,068		probably benign	Het
Lats1	T	C	10: 7,705,754	Y768H	probably damaging	Het
Mageb3	A	G	2: 121,954,387	V278A	probably damaging	Het
Mapkbp1	G	A	2: 120,019,243	R732H	probably damaging	Het
Marveld2	T	C	13: 100,600,938	I148V	probably benign	Het
Mast1	G	C	8: 84,916,260	P969A	probably damaging	Het
Myh10	T	G	11: 68,798,380	V1261G	possibly damaging	Het
Nlrp1b	A	T	11: 71,217,276	H466Q	probably benign	Het
Npr2	T	G	4: 43,650,150	V905G	probably damaging	Het
Oip5	T	A	2: 119,610,327	I240F	unknown	Het
Olfr1259	A	G	2: 89,943,585	C177R	probably damaging	Het
Olfr175-ps1	G	T	16: 58,824,153	Y185*	probably null	Het
Olfr874	T	A	9: 37,746,524	M130K	probably benign	Het
Pcsk2	G	A	2: 143,546,560	A24T	probably benign	Het
Plxnb1	G	T	9: 109,100,750	G225W	probably damaging	Het
Polr1a	T	C	6: 71,929,366	S389P	possibly damaging	Het
Prkca	A	G	11: 108,053,980	V175A	probably benign	Het
Rassf7	C	A	7: 141,217,060		probably null	Het
Rbl2	A	G	8: 91,078,932	I206V	probably benign	Het
Rnf111	A	T	9: 70,459,096	H353Q	probably benign	Het
Rpn1	T	G	6: 88,093,859	V237G	probably damaging	Het
Sec61a2	T	A	2: 5,876,540	I267F	possibly damaging	Het
Spop	G	T	11: 95,485,843	V241F	probably damaging	Het
Sptbn2	C	T	19: 4,725,950	A178V	probably damaging	Het
Stard13	A	G	5: 151,045,901	Y791H	probably benign	Het
Tcof1	T	C	18: 60,831,556	E666G	possibly damaging	Het
Tekt5	G	T	16: 10,361,390	A371E	possibly damaging	Het
Thap11	G	A	8: 105,855,916	E186K	probably damaging	Het
Tk2	A	T	8: 104,247,683	D45E	possibly damaging	Het
Tuba8	C	A	6: 121,222,913	Y185*	probably null	Het
Usp24	T	A	4: 106,416,047	Y2210N	probably damaging	Het
Wfdc8	A	T	2: 164,597,319		probably benign	Het
Zar1l	T	C	5: 150,512,900	N237S	probably damaging	Het
Zfp607b	A	T	7: 27,702,607	T163S	probably benign	Het
Zfp619	C	A	7: 39,535,153	H202Q	probably benign	Het

Other mutations in Susd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00740:Susd2	APN	10	75638048	missense	probably benign	0.02
IGL00907:Susd2	APN	10	75640931	missense	probably benign	0.04
IGL01155:Susd2	APN	10	75640892	missense	possibly damaging	0.87
IGL01677:Susd2	APN	10	75639431	missense	possibly damaging	0.91
IGL02146:Susd2	APN	10	75638433	missense	possibly damaging	0.79
IGL02273:Susd2	APN	10	75640938	missense	possibly damaging	0.94
IGL02386:Susd2	APN	10	75640095	missense	probably damaging	0.97
IGL02475:Susd2	APN	10	75637499	critical splice donor site	probably null
IGL03218:Susd2	APN	10	75642625	missense	probably benign
PIT4418001:Susd2	UTSW	10	75638349	missense	probably benign	0.24
R0135:Susd2	UTSW	10	75638514	missense	probably damaging	1.00
R0396:Susd2	UTSW	10	75639911	missense	probably damaging	1.00
R0401:Susd2	UTSW	10	75638603	splice site	probably benign
R0608:Susd2	UTSW	10	75638235	missense	probably benign	0.45
R0636:Susd2	UTSW	10	75639350	missense	probably damaging	1.00
R1470:Susd2	UTSW	10	75638054	missense	probably damaging	1.00
R1470:Susd2	UTSW	10	75638054	missense	probably damaging	1.00
R1619:Susd2	UTSW	10	75638044	missense	possibly damaging	0.66
R1634:Susd2	UTSW	10	75637555	missense	probably benign	0.04
R1866:Susd2	UTSW	10	75639732	missense	probably damaging	0.98
R4354:Susd2	UTSW	10	75639728	missense	probably damaging	0.99
R4451:Susd2	UTSW	10	75639398	missense	probably damaging	1.00
R4721:Susd2	UTSW	10	75638130	missense	probably benign	0.00
R5768:Susd2	UTSW	10	75638019	missense	probably damaging	0.98
R5769:Susd2	UTSW	10	75638019	missense	probably damaging	0.98
R5770:Susd2	UTSW	10	75638019	missense	probably damaging	0.98
R5771:Susd2	UTSW	10	75638019	missense	probably damaging	0.98
R5960:Susd2	UTSW	10	75639936	missense	probably damaging	1.00
R6152:Susd2	UTSW	10	75638019	missense	probably damaging	0.98
R6153:Susd2	UTSW	10	75638019	missense	probably damaging	0.98
R6259:Susd2	UTSW	10	75638046	missense	probably damaging	1.00
R6291:Susd2	UTSW	10	75637574	missense	possibly damaging	0.61
R7106:Susd2	UTSW	10	75638053	missense	probably damaging	1.00
R7232:Susd2	UTSW	10	75639851	missense	probably damaging	1.00
R7297:Susd2	UTSW	10	75642568	missense	probably benign	0.19
R7326:Susd2	UTSW	10	75642565	missense	probably benign	0.00
R7905:Susd2	UTSW	10	75639657	nonsense	probably null
R8512:Susd2	UTSW	10	75639651	missense	probably benign	0.13
R8888:Susd2	UTSW	10	75639618	missense	possibly damaging	0.58
R8895:Susd2	UTSW	10	75639618	missense	possibly damaging	0.58
X0025:Susd2	UTSW	10	75640572	nonsense	probably null
Z1177:Susd2	UTSW	10	75640478	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTGGGGTTGCAGATAGGAAC -3'
(R):5'- GGTCATTAGGGCTCCTACAC -3'

Sequencing Primer
(F):5'- TTGCAGATAGGAACCAGGGCC -3'
(R):5'- CTCAATCCCAAGCATAGAGTGGG -3'

Posted On

2016-10-24