Incidental Mutation 'R5546:Nlrp1b'
ID436302
Institutional Source Beutler Lab
Gene Symbol Nlrp1b
Ensembl Gene ENSMUSG00000070390
Gene NameNLR family, pyrin domain containing 1B
SynonymsNalp1b
MMRRC Submission 043104-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5546 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location71153102-71230733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71217276 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 466 (H466Q)
Ref Sequence ENSEMBL: ENSMUSP00000121155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094046] [ENSMUST00000108516] [ENSMUST00000136493]
Predicted Effect probably benign
Transcript: ENSMUST00000094046
AA Change: H466Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091588
Gene: ENSMUSG00000070390
AA Change: H466Q

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.7e-43 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 812 1064 8.2e-104 PFAM
Pfam:CARD 1083 1166 3.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108516
AA Change: H466Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104156
Gene: ENSMUSG00000070390
AA Change: H466Q

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.2e-42 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 811 1065 3.9e-136 PFAM
Pfam:CARD 1083 1166 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136493
AA Change: H466Q

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000121155
Gene: ENSMUSG00000070390
AA Change: H466Q

DomainStartEndE-ValueType
Pfam:NACHT 131 300 8.9e-43 PFAM
PDB:4IM6|A 610 662 6e-10 PDB
Blast:LRR 627 654 3e-11 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ced-4 family of apoptosis proteins. Ced-family members contain a caspase recruitment domain (CARD) and are known to be key mediators of programmed cell death. The encoded protein contains a distinct N-terminal pyrin-like motif, which is possibly involved in protein-protein interactions. This protein interacts strongly with caspase 2 and weakly with caspase 9. Overexpression of this gene was demonstrated to induce apoptosis in cells. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection from anthrax lethal toxin-induced lung injury and pyroptosis of macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,929,633 N385S probably benign Het
Ahctf1 A T 1: 179,754,068 I1523N probably benign Het
Akna C T 4: 63,394,959 G309E probably benign Het
Akna T C 4: 63,395,566 N107D probably benign Het
Arhgef15 G A 11: 68,954,051 P240L probably benign Het
Brd1 T A 15: 88,701,122 E836D probably benign Het
Brf2 A G 8: 27,124,283 S292P possibly damaging Het
C3 A G 17: 57,222,976 L500P probably damaging Het
Ccdc107 T C 4: 43,495,685 L196P probably damaging Het
Cdcp1 G T 9: 123,178,029 P551Q probably damaging Het
Ckap5 T C 2: 91,594,816 L1224P probably damaging Het
Csnk1g2 C A 10: 80,638,398 T178K probably benign Het
Ctsq A T 13: 61,037,888 C146* probably null Het
Cyp2ab1 T A 16: 20,313,757 I264F probably damaging Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 33,912,641 probably benign Het
Dnah11 G A 12: 117,975,848 T3179M possibly damaging Het
Dnah7c A T 1: 46,666,317 T2497S probably damaging Het
Eif4enif1 T C 11: 3,243,989 V776A probably damaging Het
Erbb4 G T 1: 68,298,293 T622N probably damaging Het
Erich6 A G 3: 58,618,797 Y595H probably benign Het
Fam107a C T 14: 8,298,764 A121T probably benign Het
Gif T C 19: 11,748,495 S50P possibly damaging Het
Gpatch11 C T 17: 78,842,119 Q183* probably null Het
Gpr161 C A 1: 165,306,413 F81L possibly damaging Het
Hook1 G T 4: 96,002,528 E291D probably benign Het
Hsf2bp T A 17: 31,946,695 I309F probably damaging Het
Hspg2 T C 4: 137,548,174 probably null Het
Ide T G 19: 37,272,224 M910L unknown Het
Igdcc4 A G 9: 65,128,795 Y712C probably damaging Het
Kmt2d T C 15: 98,853,068 probably benign Het
Lats1 T C 10: 7,705,754 Y768H probably damaging Het
Mageb3 A G 2: 121,954,387 V278A probably damaging Het
Mapkbp1 G A 2: 120,019,243 R732H probably damaging Het
Marveld2 T C 13: 100,600,938 I148V probably benign Het
Mast1 G C 8: 84,916,260 P969A probably damaging Het
Myh10 T G 11: 68,798,380 V1261G possibly damaging Het
Npr2 T G 4: 43,650,150 V905G probably damaging Het
Oip5 T A 2: 119,610,327 I240F unknown Het
Olfr1259 A G 2: 89,943,585 C177R probably damaging Het
Olfr175-ps1 G T 16: 58,824,153 Y185* probably null Het
Olfr874 T A 9: 37,746,524 M130K probably benign Het
Pcsk2 G A 2: 143,546,560 A24T probably benign Het
Plxnb1 G T 9: 109,100,750 G225W probably damaging Het
Polr1a T C 6: 71,929,366 S389P possibly damaging Het
Prkca A G 11: 108,053,980 V175A probably benign Het
Rassf7 C A 7: 141,217,060 probably null Het
Rbl2 A G 8: 91,078,932 I206V probably benign Het
Rnf111 A T 9: 70,459,096 H353Q probably benign Het
Rpn1 T G 6: 88,093,859 V237G probably damaging Het
Sec61a2 T A 2: 5,876,540 I267F possibly damaging Het
Spop G T 11: 95,485,843 V241F probably damaging Het
Sptbn2 C T 19: 4,725,950 A178V probably damaging Het
Stard13 A G 5: 151,045,901 Y791H probably benign Het
Susd2 T A 10: 75,642,218 I113L probably benign Het
Tcof1 T C 18: 60,831,556 E666G possibly damaging Het
Tekt5 G T 16: 10,361,390 A371E possibly damaging Het
Thap11 G A 8: 105,855,916 E186K probably damaging Het
Tk2 A T 8: 104,247,683 D45E possibly damaging Het
Tuba8 C A 6: 121,222,913 Y185* probably null Het
Usp24 T A 4: 106,416,047 Y2210N probably damaging Het
Wfdc8 A T 2: 164,597,319 probably benign Het
Zar1l T C 5: 150,512,900 N237S probably damaging Het
Zfp607b A T 7: 27,702,607 T163S probably benign Het
Zfp619 C A 7: 39,535,153 H202Q probably benign Het
Other mutations in Nlrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Nlrp1b APN 11 71181181 intron probably benign
IGL00571:Nlrp1b APN 11 71163973 missense probably null 0.48
IGL01358:Nlrp1b APN 11 71181856 missense possibly damaging 0.91
IGL01937:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL01945:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL02375:Nlrp1b APN 11 71161680 missense probably damaging 1.00
IGL02552:Nlrp1b APN 11 71182052 missense possibly damaging 0.57
IGL02552:Nlrp1b APN 11 71172231 missense possibly damaging 0.96
IGL02588:Nlrp1b APN 11 71182279 nonsense probably null
IGL02833:Nlrp1b APN 11 71161172 missense probably benign
IGL02955:Nlrp1b APN 11 71169811 missense possibly damaging 0.73
IGL03002:Nlrp1b APN 11 71168859 missense probably benign 0.00
IGL03033:Nlrp1b APN 11 71161839 missense probably benign 0.22
IGL03122:Nlrp1b APN 11 71181833 missense probably benign 0.00
IGL03131:Nlrp1b APN 11 71161915 missense possibly damaging 0.82
androcles UTSW 11 71172075 nonsense probably null
Fangled UTSW 11 71172171 missense possibly damaging 0.94
glitz UTSW 11 71181550 missense possibly damaging 0.89
honeydew UTSW 11 71217884 missense possibly damaging 0.93
Mush UTSW 11 71156079 missense probably damaging 1.00
R0001:Nlrp1b UTSW 11 71161759 missense probably damaging 1.00
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0271:Nlrp1b UTSW 11 71161765 missense possibly damaging 0.51
R0464:Nlrp1b UTSW 11 71218244 missense probably damaging 1.00
R0504:Nlrp1b UTSW 11 71182415 missense probably damaging 0.99
R0605:Nlrp1b UTSW 11 71156179 missense possibly damaging 0.88
R0863:Nlrp1b UTSW 11 71181347 missense probably benign 0.00
R1075:Nlrp1b UTSW 11 71181686 missense probably benign 0.35
R1221:Nlrp1b UTSW 11 71181464 missense probably benign 0.07
R1501:Nlrp1b UTSW 11 71156059 missense probably damaging 1.00
R1654:Nlrp1b UTSW 11 71181298 missense probably damaging 0.99
R1671:Nlrp1b UTSW 11 71201259 missense probably benign 0.45
R1676:Nlrp1b UTSW 11 71182811 missense probably benign 0.13
R1694:Nlrp1b UTSW 11 71216855 critical splice donor site probably null
R1709:Nlrp1b UTSW 11 71201273 missense probably benign 0.11
R1770:Nlrp1b UTSW 11 71160153 missense probably benign 0.22
R1775:Nlrp1b UTSW 11 71161821 missense probably damaging 1.00
R1851:Nlrp1b UTSW 11 71182616 missense possibly damaging 0.96
R1932:Nlrp1b UTSW 11 71182138 missense probably damaging 0.96
R2063:Nlrp1b UTSW 11 71161086 missense probably benign 0.09
R2189:Nlrp1b UTSW 11 71169795 missense probably damaging 1.00
R2223:Nlrp1b UTSW 11 71155989 splice site probably benign
R2284:Nlrp1b UTSW 11 71156284 missense probably benign 0.00
R2434:Nlrp1b UTSW 11 71156726 splice site probably null
R3079:Nlrp1b UTSW 11 71217968 missense probably benign 0.27
R3775:Nlrp1b UTSW 11 71156300 splice site probably benign
R3980:Nlrp1b UTSW 11 71181611 missense possibly damaging 0.56
R4016:Nlrp1b UTSW 11 71173085 missense probably damaging 1.00
R4085:Nlrp1b UTSW 11 71161762 missense probably damaging 0.98
R4542:Nlrp1b UTSW 11 71228325 missense probably damaging 1.00
R4623:Nlrp1b UTSW 11 71161843 missense probably benign 0.00
R4726:Nlrp1b UTSW 11 71181406 missense probably benign 0.10
R4764:Nlrp1b UTSW 11 71182663 missense probably damaging 1.00
R4885:Nlrp1b UTSW 11 71217884 missense possibly damaging 0.93
R4910:Nlrp1b UTSW 11 71217277 missense probably benign 0.09
R4997:Nlrp1b UTSW 11 71218334 missense probably damaging 1.00
R5046:Nlrp1b UTSW 11 71160072 missense possibly damaging 0.95
R5126:Nlrp1b UTSW 11 71181533 missense possibly damaging 0.67
R5369:Nlrp1b UTSW 11 71181799 missense probably benign
R5388:Nlrp1b UTSW 11 71172141 missense probably damaging 1.00
R5445:Nlrp1b UTSW 11 71217875 missense probably benign 0.21
R5567:Nlrp1b UTSW 11 71181403 missense probably benign
R5826:Nlrp1b UTSW 11 71181196 missense probably benign 0.17
R5955:Nlrp1b UTSW 11 71217865 missense probably damaging 1.00
R5995:Nlrp1b UTSW 11 71181746 missense probably damaging 1.00
R6059:Nlrp1b UTSW 11 71217010 missense possibly damaging 0.53
R6170:Nlrp1b UTSW 11 71156079 missense probably damaging 1.00
R6191:Nlrp1b UTSW 11 71218457 nonsense probably null
R6250:Nlrp1b UTSW 11 71181799 missense probably benign 0.11
R6312:Nlrp1b UTSW 11 71228397 missense probably benign 0.38
R6352:Nlrp1b UTSW 11 71181701 missense probably damaging 0.99
R6807:Nlrp1b UTSW 11 71217704 missense probably damaging 1.00
R6854:Nlrp1b UTSW 11 71228433 missense possibly damaging 0.93
R6908:Nlrp1b UTSW 11 71217296 missense probably benign
R6938:Nlrp1b UTSW 11 71218216 missense probably damaging 1.00
R7098:Nlrp1b UTSW 11 71218274 missense possibly damaging 0.89
R7142:Nlrp1b UTSW 11 71172075 nonsense probably null
R7149:Nlrp1b UTSW 11 71181656 nonsense probably null
R7349:Nlrp1b UTSW 11 71182117 missense probably benign 0.36
R7354:Nlrp1b UTSW 11 71181550 missense possibly damaging 0.89
R7750:Nlrp1b UTSW 11 71168839 missense probably benign 0.11
R7913:Nlrp1b UTSW 11 71217711 missense possibly damaging 0.93
R7994:Nlrp1b UTSW 11 71217711 missense possibly damaging 0.93
R8031:Nlrp1b UTSW 11 71216921 missense not run
Z1176:Nlrp1b UTSW 11 71182270 missense not run
Z1177:Nlrp1b UTSW 11 71181299 nonsense probably null
Z1177:Nlrp1b UTSW 11 71217224 missense not run
Predicted Primers PCR Primer
(F):5'- ATGTCAGGAGCACCTCTTCCTG -3'
(R):5'- GCCATTGCCACTTTCCTGAAG -3'

Sequencing Primer
(F):5'- CCTGACTTTCATACAGACAGTGGAG -3'
(R):5'- GATCGGTATCCTTCAAAAGCAGGC -3'
Posted On2016-10-24