Incidental Mutation 'R5546:Marveld2'
ID436309
Institutional Source Beutler Lab
Gene Symbol Marveld2
Ensembl Gene ENSMUSG00000021636
Gene NameMARVEL (membrane-associating) domain containing 2
SynonymsTric-b, Tricellulin, Tric, Mrvldc2, Tric-c, Tric-a
MMRRC Submission 043104-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5546 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100595957-100616971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100600938 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 148 (I148V)
Ref Sequence ENSEMBL: ENSMUSP00000129990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022137] [ENSMUST00000163163] [ENSMUST00000168772] [ENSMUST00000225754]
Predicted Effect probably benign
Transcript: ENSMUST00000022137
AA Change: I425V

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022137
Gene: ENSMUSG00000021636
AA Change: I425V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
Pfam:MARVEL 182 358 4.1e-20 PFAM
low complexity region 423 434 N/A INTRINSIC
Pfam:Occludin_ELL 443 545 2.7e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083744
Predicted Effect probably benign
Transcript: ENSMUST00000163163
AA Change: I148V

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129990
Gene: ENSMUSG00000021636
AA Change: I148V

DomainStartEndE-ValueType
low complexity region 25 53 N/A INTRINSIC
low complexity region 146 157 N/A INTRINSIC
Pfam:Occludin_ELL 166 268 4.2e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168772
AA Change: I425V

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126438
Gene: ENSMUSG00000021636
AA Change: I425V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
Pfam:MARVEL 182 358 3.6e-20 PFAM
low complexity region 423 434 N/A INTRINSIC
Pfam:Occludin_ELL 443 545 6.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225754
AA Change: I425V

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein found at the tight junctions between epithelial cells. The encoded protein helps establish epithelial barriers such as those in the organ of Corti, where these barriers are required for normal hearing. Defects in this gene are a cause of deafness autosomal recessive type 49 (DFNB49). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-in mutation fisplay syndromic deafness with rapid progressive degeneration of the hair cells, increased body and organ weights and abnormal tricellular tight junctions. However, vestibular function is intact. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,929,633 N385S probably benign Het
Ahctf1 A T 1: 179,754,068 I1523N probably benign Het
Akna C T 4: 63,394,959 G309E probably benign Het
Akna T C 4: 63,395,566 N107D probably benign Het
Arhgef15 G A 11: 68,954,051 P240L probably benign Het
Brd1 T A 15: 88,701,122 E836D probably benign Het
Brf2 A G 8: 27,124,283 S292P possibly damaging Het
C3 A G 17: 57,222,976 L500P probably damaging Het
Ccdc107 T C 4: 43,495,685 L196P probably damaging Het
Cdcp1 G T 9: 123,178,029 P551Q probably damaging Het
Ckap5 T C 2: 91,594,816 L1224P probably damaging Het
Csnk1g2 C A 10: 80,638,398 T178K probably benign Het
Ctsq A T 13: 61,037,888 C146* probably null Het
Cyp2ab1 T A 16: 20,313,757 I264F probably damaging Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 33,912,641 probably benign Het
Dnah11 G A 12: 117,975,848 T3179M possibly damaging Het
Dnah7c A T 1: 46,666,317 T2497S probably damaging Het
Eif4enif1 T C 11: 3,243,989 V776A probably damaging Het
Erbb4 G T 1: 68,298,293 T622N probably damaging Het
Erich6 A G 3: 58,618,797 Y595H probably benign Het
Fam107a C T 14: 8,298,764 A121T probably benign Het
Gif T C 19: 11,748,495 S50P possibly damaging Het
Gpatch11 C T 17: 78,842,119 Q183* probably null Het
Gpr161 C A 1: 165,306,413 F81L possibly damaging Het
Hook1 G T 4: 96,002,528 E291D probably benign Het
Hsf2bp T A 17: 31,946,695 I309F probably damaging Het
Hspg2 T C 4: 137,548,174 probably null Het
Ide T G 19: 37,272,224 M910L unknown Het
Igdcc4 A G 9: 65,128,795 Y712C probably damaging Het
Kmt2d T C 15: 98,853,068 probably benign Het
Lats1 T C 10: 7,705,754 Y768H probably damaging Het
Mageb3 A G 2: 121,954,387 V278A probably damaging Het
Mapkbp1 G A 2: 120,019,243 R732H probably damaging Het
Mast1 G C 8: 84,916,260 P969A probably damaging Het
Myh10 T G 11: 68,798,380 V1261G possibly damaging Het
Nlrp1b A T 11: 71,217,276 H466Q probably benign Het
Npr2 T G 4: 43,650,150 V905G probably damaging Het
Oip5 T A 2: 119,610,327 I240F unknown Het
Olfr1259 A G 2: 89,943,585 C177R probably damaging Het
Olfr175-ps1 G T 16: 58,824,153 Y185* probably null Het
Olfr874 T A 9: 37,746,524 M130K probably benign Het
Pcsk2 G A 2: 143,546,560 A24T probably benign Het
Plxnb1 G T 9: 109,100,750 G225W probably damaging Het
Polr1a T C 6: 71,929,366 S389P possibly damaging Het
Prkca A G 11: 108,053,980 V175A probably benign Het
Rassf7 C A 7: 141,217,060 probably null Het
Rbl2 A G 8: 91,078,932 I206V probably benign Het
Rnf111 A T 9: 70,459,096 H353Q probably benign Het
Rpn1 T G 6: 88,093,859 V237G probably damaging Het
Sec61a2 T A 2: 5,876,540 I267F possibly damaging Het
Spop G T 11: 95,485,843 V241F probably damaging Het
Sptbn2 C T 19: 4,725,950 A178V probably damaging Het
Stard13 A G 5: 151,045,901 Y791H probably benign Het
Susd2 T A 10: 75,642,218 I113L probably benign Het
Tcof1 T C 18: 60,831,556 E666G possibly damaging Het
Tekt5 G T 16: 10,361,390 A371E possibly damaging Het
Thap11 G A 8: 105,855,916 E186K probably damaging Het
Tk2 A T 8: 104,247,683 D45E possibly damaging Het
Tuba8 C A 6: 121,222,913 Y185* probably null Het
Usp24 T A 4: 106,416,047 Y2210N probably damaging Het
Wfdc8 A T 2: 164,597,319 probably benign Het
Zar1l T C 5: 150,512,900 N237S probably damaging Het
Zfp607b A T 7: 27,702,607 T163S probably benign Het
Zfp619 C A 7: 39,535,153 H202Q probably benign Het
Other mutations in Marveld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Marveld2 APN 13 100600893 missense possibly damaging 0.83
IGL00573:Marveld2 APN 13 100597859 splice site probably benign
R1569:Marveld2 UTSW 13 100600998 missense probably benign 0.32
R1884:Marveld2 UTSW 13 100600621 missense probably benign 0.15
R1958:Marveld2 UTSW 13 100597350 missense probably damaging 1.00
R2249:Marveld2 UTSW 13 100612091 missense probably benign
R2258:Marveld2 UTSW 13 100612470 missense probably benign 0.00
R2259:Marveld2 UTSW 13 100612470 missense probably benign 0.00
R2260:Marveld2 UTSW 13 100612470 missense probably benign 0.00
R2473:Marveld2 UTSW 13 100597321 missense probably damaging 0.98
R3918:Marveld2 UTSW 13 100611893 missense probably benign 0.01
R4010:Marveld2 UTSW 13 100611428 splice site probably null
R4089:Marveld2 UTSW 13 100600480 missense probably benign 0.04
R4634:Marveld2 UTSW 13 100611939 missense probably damaging 1.00
R4775:Marveld2 UTSW 13 100616795 unclassified probably benign
R4961:Marveld2 UTSW 13 100611923 missense probably benign 0.12
R5424:Marveld2 UTSW 13 100612187 missense probably benign
R5900:Marveld2 UTSW 13 100611668 missense probably damaging 1.00
R5977:Marveld2 UTSW 13 100611689 missense possibly damaging 0.87
R6177:Marveld2 UTSW 13 100597378 missense probably damaging 0.99
R7409:Marveld2 UTSW 13 100611476 missense probably damaging 0.99
R7484:Marveld2 UTSW 13 100611560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAACTGGTAAAACTGGTCAGC -3'
(R):5'- GGCTGCCTACGTTTCTATAGG -3'

Sequencing Primer
(F):5'- CTGGTAAAACTGGTCAGCTTACTGC -3'
(R):5'- CCATCAGTGATCGACAGA -3'
Posted On2016-10-24