Incidental Mutation 'R0006:Gabrd'
ID43632
Institutional Source Beutler Lab
Gene Symbol Gabrd
Ensembl Gene ENSMUSG00000029054
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit delta
Synonyms
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R0006 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155384980-155398112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 155388601 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 72 (V72L)
Ref Sequence ENSEMBL: ENSMUSP00000030925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030925]
Predicted Effect probably damaging
Transcript: ENSMUST00000030925
AA Change: V72L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030925
Gene: ENSMUSG00000029054
AA Change: V72L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 43 247 9.8e-48 PFAM
Pfam:Neur_chan_memb 254 402 6.5e-34 PFAM
transmembrane domain 426 448 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150423
Meta Mutation Damage Score 0.1567 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. The GABA-A receptor is generally pentameric and there are five types of subunits: alpha, beta, gamma, delta, and rho. This gene encodes the delta subunit. Mutations in this gene have been associated with susceptibility to generalized epilepsy with febrile seizures, type 5. Alternatively spliced transcript variants have been described for this gene, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased postpartum depression and anxiety behaviors, lethality of pups due to materal neglect, and increased cued and contextual conditional freezing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Gabrd
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0006:Gabrd UTSW 4 155388601 missense probably damaging 1.00
R0569:Gabrd UTSW 4 155385423 missense probably damaging 1.00
R1826:Gabrd UTSW 4 155386486 missense probably damaging 1.00
R4387:Gabrd UTSW 4 155388932 critical splice donor site probably null
R5071:Gabrd UTSW 4 155387162 missense probably damaging 1.00
R5650:Gabrd UTSW 4 155388624 missense probably damaging 1.00
R5818:Gabrd UTSW 4 155388361 missense probably damaging 1.00
R6045:Gabrd UTSW 4 155386474 missense possibly damaging 0.82
R6301:Gabrd UTSW 4 155387267 missense probably damaging 0.96
R7064:Gabrd UTSW 4 155388346 missense probably damaging 1.00
R7146:Gabrd UTSW 4 155385406 missense probably benign
R7426:Gabrd UTSW 4 155385513 missense possibly damaging 0.81
R7451:Gabrd UTSW 4 155388459 missense possibly damaging 0.72
R7732:Gabrd UTSW 4 155385618 missense probably benign 0.00
R7784:Gabrd UTSW 4 155388932 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCATTCACGATGAAGGTGTCAGG -3'
(R):5'- ACTGAGGCAAATATGTAACGGCTCC -3'

Sequencing Primer
(F):5'- TAGCTTGTCCACAAAGCGG -3'
(R):5'- ATATGTAACGGCTCCAAGTTCC -3'
Posted On2013-05-29