Incidental Mutation 'R5546:Gpatch11'
ID436320
Institutional Source Beutler Lab
Gene Symbol Gpatch11
Ensembl Gene ENSMUSG00000050668
Gene NameG patch domain containing 11
Synonyms
MMRRC Submission 043104-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5546 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location78835516-78848299 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 78842119 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 183 (Q183*)
Ref Sequence ENSEMBL: ENSMUSP00000126814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170759]
Predicted Effect probably null
Transcript: ENSMUST00000170759
AA Change: Q183*
SMART Domains Protein: ENSMUSP00000126814
Gene: ENSMUSG00000050668
AA Change: Q183*

DomainStartEndE-ValueType
G_patch 71 117 5.8e-14 SMART
DUF4187 195 263 1.51e-25 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,929,633 N385S probably benign Het
Ahctf1 A T 1: 179,754,068 I1523N probably benign Het
Akna C T 4: 63,394,959 G309E probably benign Het
Akna T C 4: 63,395,566 N107D probably benign Het
Arhgef15 G A 11: 68,954,051 P240L probably benign Het
Brd1 T A 15: 88,701,122 E836D probably benign Het
Brf2 A G 8: 27,124,283 S292P possibly damaging Het
C3 A G 17: 57,222,976 L500P probably damaging Het
Ccdc107 T C 4: 43,495,685 L196P probably damaging Het
Cdcp1 G T 9: 123,178,029 P551Q probably damaging Het
Ckap5 T C 2: 91,594,816 L1224P probably damaging Het
Csnk1g2 C A 10: 80,638,398 T178K probably benign Het
Ctsq A T 13: 61,037,888 C146* probably null Het
Cyp2ab1 T A 16: 20,313,757 I264F probably damaging Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 33,912,641 probably benign Het
Dnah11 G A 12: 117,975,848 T3179M possibly damaging Het
Dnah7c A T 1: 46,666,317 T2497S probably damaging Het
Eif4enif1 T C 11: 3,243,989 V776A probably damaging Het
Erbb4 G T 1: 68,298,293 T622N probably damaging Het
Erich6 A G 3: 58,618,797 Y595H probably benign Het
Fam107a C T 14: 8,298,764 A121T probably benign Het
Gif T C 19: 11,748,495 S50P possibly damaging Het
Gpr161 C A 1: 165,306,413 F81L possibly damaging Het
Hook1 G T 4: 96,002,528 E291D probably benign Het
Hsf2bp T A 17: 31,946,695 I309F probably damaging Het
Hspg2 T C 4: 137,548,174 probably null Het
Ide T G 19: 37,272,224 M910L unknown Het
Igdcc4 A G 9: 65,128,795 Y712C probably damaging Het
Kmt2d T C 15: 98,853,068 probably benign Het
Lats1 T C 10: 7,705,754 Y768H probably damaging Het
Mageb3 A G 2: 121,954,387 V278A probably damaging Het
Mapkbp1 G A 2: 120,019,243 R732H probably damaging Het
Marveld2 T C 13: 100,600,938 I148V probably benign Het
Mast1 G C 8: 84,916,260 P969A probably damaging Het
Myh10 T G 11: 68,798,380 V1261G possibly damaging Het
Nlrp1b A T 11: 71,217,276 H466Q probably benign Het
Npr2 T G 4: 43,650,150 V905G probably damaging Het
Oip5 T A 2: 119,610,327 I240F unknown Het
Olfr1259 A G 2: 89,943,585 C177R probably damaging Het
Olfr175-ps1 G T 16: 58,824,153 Y185* probably null Het
Olfr874 T A 9: 37,746,524 M130K probably benign Het
Pcsk2 G A 2: 143,546,560 A24T probably benign Het
Plxnb1 G T 9: 109,100,750 G225W probably damaging Het
Polr1a T C 6: 71,929,366 S389P possibly damaging Het
Prkca A G 11: 108,053,980 V175A probably benign Het
Rassf7 C A 7: 141,217,060 probably null Het
Rbl2 A G 8: 91,078,932 I206V probably benign Het
Rnf111 A T 9: 70,459,096 H353Q probably benign Het
Rpn1 T G 6: 88,093,859 V237G probably damaging Het
Sec61a2 T A 2: 5,876,540 I267F possibly damaging Het
Spop G T 11: 95,485,843 V241F probably damaging Het
Sptbn2 C T 19: 4,725,950 A178V probably damaging Het
Stard13 A G 5: 151,045,901 Y791H probably benign Het
Susd2 T A 10: 75,642,218 I113L probably benign Het
Tcof1 T C 18: 60,831,556 E666G possibly damaging Het
Tekt5 G T 16: 10,361,390 A371E possibly damaging Het
Thap11 G A 8: 105,855,916 E186K probably damaging Het
Tk2 A T 8: 104,247,683 D45E possibly damaging Het
Tuba8 C A 6: 121,222,913 Y185* probably null Het
Usp24 T A 4: 106,416,047 Y2210N probably damaging Het
Wfdc8 A T 2: 164,597,319 probably benign Het
Zar1l T C 5: 150,512,900 N237S probably damaging Het
Zfp607b A T 7: 27,702,607 T163S probably benign Het
Zfp619 C A 7: 39,535,153 H202Q probably benign Het
Other mutations in Gpatch11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Gpatch11 APN 17 78842164 missense probably benign
IGL02125:Gpatch11 APN 17 78840109 missense probably benign 0.21
IGL02183:Gpatch11 APN 17 78842231 critical splice donor site probably null
IGL02223:Gpatch11 APN 17 78845179 missense probably benign 0.23
IGL02224:Gpatch11 APN 17 78841093 splice site probably benign
IGL03116:Gpatch11 APN 17 78843853 nonsense probably null
FR4340:Gpatch11 UTSW 17 78842174 small insertion probably benign
FR4342:Gpatch11 UTSW 17 78842178 small insertion probably benign
FR4449:Gpatch11 UTSW 17 78842168 small insertion probably benign
FR4449:Gpatch11 UTSW 17 78842176 small insertion probably benign
FR4449:Gpatch11 UTSW 17 78842181 small insertion probably benign
FR4548:Gpatch11 UTSW 17 78842175 small insertion probably benign
FR4737:Gpatch11 UTSW 17 78842171 small insertion probably benign
FR4737:Gpatch11 UTSW 17 78842180 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842170 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842171 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842172 small insertion probably benign
FR4976:Gpatch11 UTSW 17 78842173 nonsense probably null
FR4976:Gpatch11 UTSW 17 78842180 small insertion probably benign
R1670:Gpatch11 UTSW 17 78839100 missense possibly damaging 0.85
R1986:Gpatch11 UTSW 17 78843837 missense probably benign 0.04
R2071:Gpatch11 UTSW 17 78841085 critical splice donor site probably null
R3056:Gpatch11 UTSW 17 78843843 missense probably damaging 1.00
R4348:Gpatch11 UTSW 17 78841017 missense probably damaging 1.00
R4352:Gpatch11 UTSW 17 78841017 missense probably damaging 1.00
R5426:Gpatch11 UTSW 17 78841234 missense possibly damaging 0.47
R6681:Gpatch11 UTSW 17 78840099 missense probably damaging 1.00
R7221:Gpatch11 UTSW 17 78842117 missense possibly damaging 0.69
R7409:Gpatch11 UTSW 17 78839166 missense probably damaging 1.00
R7662:Gpatch11 UTSW 17 78839055 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GGAGACACACTCTAATTCTCCCTTC -3'
(R):5'- TATGTGGTACCGCTACACAGC -3'

Sequencing Primer
(F):5'- CAGTCCTCACTGTGGTCCAG -3'
(R):5'- GAATTACCCAGCTTCAAGTGAG -3'
Posted On2016-10-24