Incidental Mutation 'R5547:Gpr161'
ID436328
Institutional Source Beutler Lab
Gene Symbol Gpr161
Ensembl Gene ENSMUSG00000040836
Gene NameG protein-coupled receptor 161
SynonymsLOC240888, vl
MMRRC Submission 043105-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5547 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location165295789-165326745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 165306413 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 81 (F81L)
Ref Sequence ENSEMBL: ENSMUSP00000136621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111450] [ENSMUST00000178700]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111450
AA Change: F64L

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107077
Gene: ENSMUSG00000040836
AA Change: F64L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 261 1.1e-6 PFAM
Pfam:7tm_1 57 337 3e-47 PFAM
low complexity region 476 489 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178700
AA Change: F81L

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136621
Gene: ENSMUSG00000040836
AA Change: F81L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 63 273 1.5e-7 PFAM
Pfam:7tm_1 72 352 9.2e-48 PFAM
low complexity region 491 504 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Upon ligand binding, G protein-coupled receptors, such as GPR161, activate cytoplasmic G proteins (see GNAS, MIM 139320), allowing the receptors to transduce extracellular signals across the plasma membrane into the cell. Phosphorylation of the receptor attenuates signaling (Matteson et al., 2008 [PubMed 18250320]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a null mutation display complete embryonic lethality during organogenesis, extensive craniofacial abnormalities, ventralization of the neural tube with expansion of the floor plate, absence of limb development, and caudal spina bifida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh7a1 A G 18: 56,528,284 S492P probably damaging Het
Arfgef1 A T 1: 10,160,976 D1133E probably damaging Het
Avpi1 T C 19: 42,124,943 K25R probably damaging Het
Bank1 T C 3: 136,066,349 S708G probably damaging Het
C1qtnf2 A G 11: 43,490,967 E202G probably damaging Het
C6 T A 15: 4,808,488 V860E probably benign Het
Cbr1 T A 16: 93,609,810 V138E probably damaging Het
Cdip1 A G 16: 4,770,124 S2P probably damaging Het
Cep126 T C 9: 8,100,427 N702S probably damaging Het
Chek1 T C 9: 36,712,104 I381V probably benign Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cryz C T 3: 154,611,557 R138* probably null Het
Ctsll3 T A 13: 60,800,737 M103L probably benign Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 33,912,641 probably benign Het
Daxx CGATGATGATGA CGA 17: 33,912,659 probably benign Het
Dsg1a T G 18: 20,336,040 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Flt1 T A 5: 147,655,138 S505C probably damaging Het
Gm11127 G A 17: 36,057,904 H95Y possibly damaging Het
Hmcn1 A G 1: 150,737,506 V1390A possibly damaging Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Klhl3 C T 13: 58,102,429 probably null Het
Lekr1 T A 3: 65,669,180 probably null Het
Lhx5 A G 5: 120,434,610 Q98R probably benign Het
Nuggc A G 14: 65,641,881 K681E possibly damaging Het
Numa1 G T 7: 102,013,930 A735S probably damaging Het
Olfr201 G A 16: 59,269,116 L184F probably benign Het
Oog3 A T 4: 144,158,028 L446Q probably benign Het
Otogl C T 10: 107,782,048 E1735K possibly damaging Het
Pcsk5 T C 19: 17,752,124 D119G probably benign Het
Pgpep1 T C 8: 70,652,419 K64E probably benign Het
Prr19 A C 7: 25,303,963 D334A probably damaging Het
Ptprh G T 7: 4,554,222 S691* probably null Het
Recql4 G A 15: 76,705,794 R684* probably null Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rnf40 T C 7: 127,589,130 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tdo2 T C 3: 81,958,940 R339G probably damaging Het
Tmem245 C T 4: 56,910,156 probably null Het
Trim24 A G 6: 37,965,550 E965G probably damaging Het
Trmt112 T C 19: 6,910,788 S103P probably damaging Het
Trpv6 A T 6: 41,636,154 V26D possibly damaging Het
Zfp850 A G 7: 27,989,419 C455R probably damaging Het
Zfp946 T C 17: 22,454,892 I209T probably benign Het
Zfp957 T C 14: 79,213,966 N131S probably benign Het
Other mutations in Gpr161
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Gpr161 APN 1 165318803 missense probably benign
IGL01090:Gpr161 APN 1 165306580 missense probably damaging 1.00
IGL01151:Gpr161 APN 1 165321509 missense probably damaging 1.00
IGL01763:Gpr161 APN 1 165317251 missense probably benign 0.09
IGL03206:Gpr161 APN 1 165321649 missense probably damaging 1.00
IGL03279:Gpr161 APN 1 165310529 missense probably damaging 1.00
IGL03378:Gpr161 APN 1 165310508 missense probably damaging 0.99
IGL03147:Gpr161 UTSW 1 165317308 missense probably benign 0.30
R0367:Gpr161 UTSW 1 165317236 splice site probably benign
R1827:Gpr161 UTSW 1 165306567 missense possibly damaging 0.94
R1970:Gpr161 UTSW 1 165306358 missense probably damaging 0.97
R1991:Gpr161 UTSW 1 165306563 missense probably damaging 0.98
R2425:Gpr161 UTSW 1 165310623 missense possibly damaging 0.83
R4805:Gpr161 UTSW 1 165306460 missense probably damaging 1.00
R5416:Gpr161 UTSW 1 165321461 missense probably benign 0.00
R5546:Gpr161 UTSW 1 165306413 missense possibly damaging 0.88
R5824:Gpr161 UTSW 1 165310991 missense possibly damaging 0.94
R6152:Gpr161 UTSW 1 165310295 missense possibly damaging 0.58
R6658:Gpr161 UTSW 1 165306567 missense possibly damaging 0.50
R6924:Gpr161 UTSW 1 165321619 missense possibly damaging 0.83
R7128:Gpr161 UTSW 1 165310457 missense possibly damaging 0.92
R7216:Gpr161 UTSW 1 165306546 missense probably benign 0.22
R7540:Gpr161 UTSW 1 165318835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCATGAGCCTCAACTCC -3'
(R):5'- AGCTCTCCAAGTCTGATGCAAAC -3'

Sequencing Primer
(F):5'- TCCTCCCTCAGCTACAGGAAGG -3'
(R):5'- CTGATGCAAACTTACCGATCGATGG -3'
Posted On2016-10-24