Mutagenetix > Incidental Mutation

Incidental Mutation 'R5547:Spag17'

436332

Institutional Source

Beutler Lab

Gene Symbol

Spag17

Ensembl Gene

ENSMUSG00000027867

Gene Name

sperm associated antigen 17

Synonyms

PF6, 4931427F14Rik

MMRRC Submission

043105-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5547 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99792722-100050638 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99963468 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1062 (V1062A)

Ref Sequence

ENSEMBL: ENSMUSP00000134066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164539]

AlphaFold

Q5S003

Predicted Effect

probably benign
Transcript: ENSMUST00000164539
AA Change: V1062A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: V1062A

Domain	Start	End	E-Value	Type
low complexity region	155	170	N/A	INTRINSIC
low complexity region	384	400	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
coiled coil region	909	964	N/A	INTRINSIC
coiled coil region	1079	1120	N/A	INTRINSIC
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1192	1205	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1223	1238	N/A	INTRINSIC
low complexity region	1394	1405	N/A	INTRINSIC
low complexity region	1931	1942	N/A	INTRINSIC
Pfam:PapD-like	2171	2277	1.2e-15	PFAM

Meta Mutation Damage Score

0.0977

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh7a1	A	G	18: 56,661,356 (GRCm39)	S492P	probably damaging	Het
Arfgef1	A	T	1: 10,231,201 (GRCm39)	D1133E	probably damaging	Het
Avpi1	T	C	19: 42,113,382 (GRCm39)	K25R	probably damaging	Het
Bank1	T	C	3: 135,772,110 (GRCm39)	S708G	probably damaging	Het
C1qtnf2	A	G	11: 43,381,794 (GRCm39)	E202G	probably damaging	Het
C6	T	A	15: 4,837,970 (GRCm39)	V860E	probably benign	Het
Cbr1	T	A	16: 93,406,698 (GRCm39)	V138E	probably damaging	Het
Cdip1	A	G	16: 4,587,988 (GRCm39)	S2P	probably damaging	Het
Cep126	T	C	9: 8,100,428 (GRCm39)	N702S	probably damaging	Het
Chek1	T	C	9: 36,623,400 (GRCm39)	I381V	probably benign	Het
Clock	G	A	5: 76,378,185 (GRCm39)	P572S	probably benign	Het
Cryz	C	T	3: 154,317,194 (GRCm39)	R138*	probably null	Het
Ctsll3	T	A	13: 60,948,551 (GRCm39)	M103L	probably benign	Het
Daxx	TGATGATGACGATGATGACGATGATGA	TGATGATGACGATGATGA	17: 34,131,615 (GRCm39)		probably benign	Het
Daxx	CGATGATGATGA	CGA	17: 34,131,633 (GRCm39)		probably benign	Het
Dsg1a	T	G	18: 20,469,097 (GRCm39)		probably null	Het
Eya4	T	C	10: 22,985,753 (GRCm39)	E583G	possibly damaging	Het
Flt1	T	A	5: 147,591,948 (GRCm39)	S505C	probably damaging	Het
Gpr161	C	A	1: 165,133,982 (GRCm39)	F81L	possibly damaging	Het
H2-T15	G	A	17: 36,368,796 (GRCm39)	H95Y	possibly damaging	Het
Hmcn1	A	G	1: 150,613,257 (GRCm39)	V1390A	possibly damaging	Het
Ifi44l	C	T	3: 151,467,142 (GRCm39)	V63I	unknown	Het
Klhl3	C	T	13: 58,250,243 (GRCm39)		probably null	Het
Lekr1	T	A	3: 65,576,601 (GRCm39)		probably null	Het
Lhx5	A	G	5: 120,572,675 (GRCm39)	Q98R	probably benign	Het
Nuggc	A	G	14: 65,879,330 (GRCm39)	K681E	possibly damaging	Het
Numa1	G	T	7: 101,663,137 (GRCm39)	A735S	probably damaging	Het
Oog3	A	T	4: 143,884,598 (GRCm39)	L446Q	probably benign	Het
Or5ac19	G	A	16: 59,089,479 (GRCm39)	L184F	probably benign	Het
Otogl	C	T	10: 107,617,909 (GRCm39)	E1735K	possibly damaging	Het
Pcsk5	T	C	19: 17,729,488 (GRCm39)	D119G	probably benign	Het
Pgpep1	T	C	8: 71,105,069 (GRCm39)	K64E	probably benign	Het
Prr19	A	C	7: 25,003,388 (GRCm39)	D334A	probably damaging	Het
Ptprh	G	T	7: 4,557,221 (GRCm39)	S691*	probably null	Het
Recql4	G	A	15: 76,589,994 (GRCm39)	R684*	probably null	Het
Rnf112	C	T	11: 61,341,854 (GRCm39)	V317I	possibly damaging	Het
Rnf40	T	C	7: 127,188,302 (GRCm39)		probably null	Het
Secisbp2l	C	T	2: 125,582,657 (GRCm39)	G933D	possibly damaging	Het
Tbc1d1	A	G	5: 64,481,887 (GRCm39)	D696G	possibly damaging	Het
Tdo2	T	C	3: 81,866,247 (GRCm39)	R339G	probably damaging	Het
Tmem245	C	T	4: 56,910,156 (GRCm39)		probably null	Het
Trim24	A	G	6: 37,942,485 (GRCm39)	E965G	probably damaging	Het
Trmt112	T	C	19: 6,888,156 (GRCm39)	S103P	probably damaging	Het
Trpv6	A	T	6: 41,613,088 (GRCm39)	V26D	possibly damaging	Het
Zfp850	A	G	7: 27,688,844 (GRCm39)	C455R	probably damaging	Het
Zfp946	T	C	17: 22,673,873 (GRCm39)	I209T	probably benign	Het
Zfp957	T	C	14: 79,451,406 (GRCm39)	N131S	probably benign	Het

Other mutations in Spag17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Spag17	APN	3	99,970,691 (GRCm39)	missense	probably benign	0.00
IGL01143:Spag17	APN	3	99,846,614 (GRCm39)	missense	probably benign	0.00
IGL01329:Spag17	APN	3	100,002,865 (GRCm39)	missense	probably benign	0.16
IGL01393:Spag17	APN	3	99,934,926 (GRCm39)	missense	possibly damaging	0.53
IGL01617:Spag17	APN	3	100,016,824 (GRCm39)	missense	possibly damaging	0.65
IGL01705:Spag17	APN	3	99,930,046 (GRCm39)	missense	probably benign	0.01
IGL01928:Spag17	APN	3	99,847,390 (GRCm39)	splice site	probably benign
IGL01981:Spag17	APN	3	99,966,149 (GRCm39)	missense	probably benign	0.03
IGL02435:Spag17	APN	3	99,889,760 (GRCm39)	missense	possibly damaging	0.53
IGL02452:Spag17	APN	3	99,934,707 (GRCm39)	missense	probably benign	0.00
IGL02465:Spag17	APN	3	99,983,187 (GRCm39)	missense	probably damaging	0.96
IGL02615:Spag17	APN	3	99,979,401 (GRCm39)	missense	probably benign	0.09
IGL02751:Spag17	APN	3	99,918,110 (GRCm39)	nonsense	probably null
IGL02803:Spag17	APN	3	100,016,713 (GRCm39)	missense	probably benign
IGL02898:Spag17	APN	3	100,008,702 (GRCm39)	missense	probably benign	0.00
IGL03037:Spag17	APN	3	99,979,486 (GRCm39)	splice site	probably null
IGL03068:Spag17	APN	3	99,987,521 (GRCm39)	missense	probably benign	0.35
IGL03131:Spag17	APN	3	99,918,075 (GRCm39)	missense	possibly damaging	0.85
IGL03224:Spag17	APN	3	99,918,156 (GRCm39)	missense	possibly damaging	0.53
FR4342:Spag17	UTSW	3	99,963,568 (GRCm39)	small insertion	probably benign
FR4342:Spag17	UTSW	3	99,963,565 (GRCm39)	small insertion	probably benign
FR4548:Spag17	UTSW	3	99,963,570 (GRCm39)	small insertion	probably benign
FR4589:Spag17	UTSW	3	99,963,574 (GRCm39)	small insertion	probably benign
FR4589:Spag17	UTSW	3	99,963,561 (GRCm39)	small insertion	probably benign
FR4737:Spag17	UTSW	3	99,963,573 (GRCm39)	small insertion	probably benign
FR4976:Spag17	UTSW	3	99,963,571 (GRCm39)	small insertion	probably benign
FR4976:Spag17	UTSW	3	99,963,570 (GRCm39)	small insertion	probably benign
N/A:Spag17	UTSW	3	99,889,570 (GRCm39)	splice site	probably benign
PIT4504001:Spag17	UTSW	3	100,010,426 (GRCm39)	critical splice acceptor site	probably null
PIT4514001:Spag17	UTSW	3	99,920,527 (GRCm39)	missense	possibly damaging	0.53
R0107:Spag17	UTSW	3	99,958,103 (GRCm39)	missense	possibly damaging	0.72
R0230:Spag17	UTSW	3	100,014,143 (GRCm39)	missense	probably benign	0.08
R0243:Spag17	UTSW	3	99,992,684 (GRCm39)	missense	probably benign	0.04
R0321:Spag17	UTSW	3	100,008,719 (GRCm39)	missense	probably damaging	0.99
R0375:Spag17	UTSW	3	99,934,906 (GRCm39)	missense	probably benign
R0417:Spag17	UTSW	3	99,972,870 (GRCm39)	missense	probably benign	0.11
R0490:Spag17	UTSW	3	99,889,727 (GRCm39)	missense	probably damaging	0.97
R0537:Spag17	UTSW	3	100,032,618 (GRCm39)	missense	probably damaging	0.98
R0714:Spag17	UTSW	3	99,987,472 (GRCm39)	missense	probably damaging	0.97
R0844:Spag17	UTSW	3	99,912,101 (GRCm39)	missense	probably benign
R0919:Spag17	UTSW	3	99,979,259 (GRCm39)	splice site	probably benign
R0926:Spag17	UTSW	3	99,979,432 (GRCm39)	missense	probably benign
R1037:Spag17	UTSW	3	100,010,433 (GRCm39)	missense	probably benign	0.01
R1075:Spag17	UTSW	3	100,000,992 (GRCm39)	missense	probably damaging	0.99
R1109:Spag17	UTSW	3	99,934,667 (GRCm39)	missense	possibly damaging	0.86
R1213:Spag17	UTSW	3	100,002,954 (GRCm39)	missense	probably benign	0.01
R1221:Spag17	UTSW	3	99,889,584 (GRCm39)	missense	possibly damaging	0.72
R1576:Spag17	UTSW	3	99,846,679 (GRCm39)	missense	possibly damaging	0.73
R1586:Spag17	UTSW	3	99,929,068 (GRCm39)	missense	possibly damaging	0.53
R1768:Spag17	UTSW	3	99,934,668 (GRCm39)	missense	possibly damaging	0.53
R1782:Spag17	UTSW	3	99,918,070 (GRCm39)	missense	probably benign	0.02
R1789:Spag17	UTSW	3	99,846,672 (GRCm39)	missense	possibly damaging	0.73
R1945:Spag17	UTSW	3	99,847,298 (GRCm39)	missense	probably benign
R2065:Spag17	UTSW	3	99,920,524 (GRCm39)	missense	probably benign	0.03
R2118:Spag17	UTSW	3	99,956,556 (GRCm39)	missense	possibly damaging	0.72
R2265:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2266:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2267:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2268:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2271:Spag17	UTSW	3	100,014,113 (GRCm39)	missense	probably damaging	1.00
R2389:Spag17	UTSW	3	100,014,153 (GRCm39)	missense	probably benign	0.27
R2420:Spag17	UTSW	3	99,934,935 (GRCm39)	missense	probably benign
R2422:Spag17	UTSW	3	99,934,935 (GRCm39)	missense	probably benign
R2423:Spag17	UTSW	3	100,010,772 (GRCm39)	missense	probably benign
R3407:Spag17	UTSW	3	99,992,615 (GRCm39)	missense	probably benign	0.09
R3801:Spag17	UTSW	3	99,961,169 (GRCm39)	missense	possibly damaging	0.53
R3856:Spag17	UTSW	3	100,014,075 (GRCm39)	missense	probably damaging	1.00
R4021:Spag17	UTSW	3	99,956,546 (GRCm39)	missense	probably benign	0.00
R4022:Spag17	UTSW	3	99,956,546 (GRCm39)	missense	probably benign	0.00
R4408:Spag17	UTSW	3	100,010,694 (GRCm39)	missense	probably benign
R4468:Spag17	UTSW	3	99,992,682 (GRCm39)	missense	probably damaging	0.98
R4540:Spag17	UTSW	3	99,995,697 (GRCm39)	missense	probably damaging	1.00
R4621:Spag17	UTSW	3	100,010,559 (GRCm39)	missense	probably benign	0.08
R4622:Spag17	UTSW	3	100,010,559 (GRCm39)	missense	probably benign	0.08
R4756:Spag17	UTSW	3	100,010,701 (GRCm39)	missense	possibly damaging	0.68
R4797:Spag17	UTSW	3	99,891,795 (GRCm39)	missense	possibly damaging	0.70
R4855:Spag17	UTSW	3	99,970,649 (GRCm39)	missense	probably benign	0.02
R4887:Spag17	UTSW	3	99,958,147 (GRCm39)	missense	probably damaging	1.00
R4962:Spag17	UTSW	3	99,934,939 (GRCm39)	missense	probably benign
R5030:Spag17	UTSW	3	99,992,657 (GRCm39)	nonsense	probably null
R5042:Spag17	UTSW	3	99,979,465 (GRCm39)	missense	probably damaging	1.00
R5074:Spag17	UTSW	3	99,987,434 (GRCm39)	missense	possibly damaging	0.94
R5195:Spag17	UTSW	3	100,008,704 (GRCm39)	missense	probably benign	0.16
R5200:Spag17	UTSW	3	99,970,787 (GRCm39)	nonsense	probably null
R5267:Spag17	UTSW	3	99,969,264 (GRCm39)	missense	probably damaging	0.98
R5360:Spag17	UTSW	3	100,016,726 (GRCm39)	missense	probably benign	0.00
R5444:Spag17	UTSW	3	99,963,468 (GRCm39)	missense	probably benign	0.06
R5498:Spag17	UTSW	3	100,010,661 (GRCm39)	missense	possibly damaging	0.83
R5503:Spag17	UTSW	3	99,934,560 (GRCm39)	missense	possibly damaging	0.72
R5540:Spag17	UTSW	3	99,963,588 (GRCm39)	missense	possibly damaging	0.91
R5575:Spag17	UTSW	3	99,961,138 (GRCm39)	missense	possibly damaging	0.85
R5629:Spag17	UTSW	3	99,987,435 (GRCm39)	missense	probably benign	0.33
R5639:Spag17	UTSW	3	99,963,482 (GRCm39)	missense	probably damaging	1.00
R5842:Spag17	UTSW	3	99,846,566 (GRCm39)	missense	possibly damaging	0.85
R5976:Spag17	UTSW	3	100,003,107 (GRCm39)	nonsense	probably null
R6082:Spag17	UTSW	3	100,031,501 (GRCm39)	missense	possibly damaging	0.46
R6228:Spag17	UTSW	3	99,929,918 (GRCm39)	missense	probably benign	0.33
R6254:Spag17	UTSW	3	99,972,901 (GRCm39)	missense	probably benign	0.03
R6321:Spag17	UTSW	3	99,995,743 (GRCm39)	missense	probably benign	0.05
R6446:Spag17	UTSW	3	100,010,448 (GRCm39)	missense	probably benign
R6687:Spag17	UTSW	3	100,000,266 (GRCm39)	missense	probably benign	0.07
R6853:Spag17	UTSW	3	99,920,551 (GRCm39)	missense	possibly damaging	0.86
R6946:Spag17	UTSW	3	99,911,999 (GRCm39)	missense	possibly damaging	0.53
R6953:Spag17	UTSW	3	99,942,291 (GRCm39)	missense	possibly damaging	0.53
R7038:Spag17	UTSW	3	99,891,925 (GRCm39)	missense	probably benign	0.00
R7084:Spag17	UTSW	3	99,846,586 (GRCm39)	missense	probably benign	0.18
R7126:Spag17	UTSW	3	100,008,751 (GRCm39)	missense	probably benign	0.00
R7144:Spag17	UTSW	3	99,934,717 (GRCm39)	splice site	probably null
R7198:Spag17	UTSW	3	100,002,888 (GRCm39)	missense	probably benign	0.02
R7318:Spag17	UTSW	3	99,847,299 (GRCm39)	missense	probably benign	0.00
R7403:Spag17	UTSW	3	99,846,691 (GRCm39)	missense	possibly damaging	0.53
R7409:Spag17	UTSW	3	99,934,547 (GRCm39)	missense	possibly damaging	0.73
R7409:Spag17	UTSW	3	99,941,475 (GRCm39)	missense	probably benign	0.00
R7537:Spag17	UTSW	3	99,846,563 (GRCm39)	missense	possibly damaging	0.96
R7609:Spag17	UTSW	3	100,002,911 (GRCm39)	nonsense	probably null
R7772:Spag17	UTSW	3	99,987,434 (GRCm39)	missense	probably damaging	0.98
R7842:Spag17	UTSW	3	99,961,174 (GRCm39)	missense	probably benign	0.18
R7963:Spag17	UTSW	3	99,929,954 (GRCm39)	missense	probably benign	0.02
R8168:Spag17	UTSW	3	99,942,300 (GRCm39)	missense	possibly damaging	0.96
R8291:Spag17	UTSW	3	99,968,166 (GRCm39)	missense	probably benign
R8347:Spag17	UTSW	3	99,934,957 (GRCm39)	missense	probably benign
R8383:Spag17	UTSW	3	99,992,708 (GRCm39)	missense	probably damaging	0.98
R8474:Spag17	UTSW	3	99,934,586 (GRCm39)	missense	probably benign	0.00
R8528:Spag17	UTSW	3	100,031,501 (GRCm39)	missense	possibly damaging	0.46
R8804:Spag17	UTSW	3	99,874,506 (GRCm39)	missense	probably benign
R8809:Spag17	UTSW	3	99,889,738 (GRCm39)	missense	probably benign	0.33
R8818:Spag17	UTSW	3	99,920,543 (GRCm39)	missense	probably benign	0.02
R8830:Spag17	UTSW	3	100,032,751 (GRCm39)	missense	possibly damaging	0.77
R8890:Spag17	UTSW	3	99,911,994 (GRCm39)	missense	possibly damaging	0.73
R9008:Spag17	UTSW	3	99,934,942 (GRCm39)	missense	possibly damaging	0.73
R9095:Spag17	UTSW	3	99,912,092 (GRCm39)	missense	possibly damaging	0.86
R9143:Spag17	UTSW	3	99,934,906 (GRCm39)	missense	probably benign
R9182:Spag17	UTSW	3	99,966,158 (GRCm39)	missense	possibly damaging	0.92
R9211:Spag17	UTSW	3	100,032,614 (GRCm39)	critical splice acceptor site	probably benign
R9344:Spag17	UTSW	3	100,010,793 (GRCm39)	missense	probably benign	0.01
R9354:Spag17	UTSW	3	99,934,905 (GRCm39)	missense	probably benign
R9527:Spag17	UTSW	3	99,970,777 (GRCm39)	missense	probably damaging	1.00
R9658:Spag17	UTSW	3	99,934,932 (GRCm39)	missense	possibly damaging	0.93
R9738:Spag17	UTSW	3	99,934,526 (GRCm39)	missense	possibly damaging	0.53
X0025:Spag17	UTSW	3	100,008,767 (GRCm39)	missense	probably benign	0.31
Z1088:Spag17	UTSW	3	100,002,946 (GRCm39)	missense	probably benign	0.09
Z1176:Spag17	UTSW	3	99,920,309 (GRCm39)	missense	probably benign	0.18
Z1177:Spag17	UTSW	3	99,995,715 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAAACCCTCCTTGTCCATG -3'
(R):5'- CTTACTTACCAGAGCCCAGC -3'

Sequencing Primer
(F):5'- GCTTCCTTTTGGCATCCCTGTATAG -3'
(R):5'- GGCAAAGACACTCACTCATTTC -3'

Posted On

2016-10-24