Incidental Mutation 'R5547:Eya4'
ID436353
Institutional Source Beutler Lab
Gene Symbol Eya4
Ensembl Gene ENSMUSG00000010461
Gene NameEYA transcriptional coactivator and phosphatase 4
SynonymsB130023L16Rik
MMRRC Submission 043105-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5547 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location23102963-23350786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23109854 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 583 (E583G)
Ref Sequence ENSEMBL: ENSMUSP00000090335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074366] [ENSMUST00000092665] [ENSMUST00000219315] [ENSMUST00000220299]
Predicted Effect probably benign
Transcript: ENSMUST00000074366
SMART Domains Protein: ENSMUSP00000073970
Gene: ENSMUSG00000010461

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-163 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000092665
AA Change: E583G

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090335
Gene: ENSMUSG00000010461
AA Change: E583G

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-172 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218867
Predicted Effect probably benign
Transcript: ENSMUST00000219315
AA Change: E606G

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000220299
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator through its protein phosphatase activity, and it may be important for eye development, and for continued function of the mature organ of Corti. Mutations in this gene are associated with postlingual, progressive, autosomal dominant hearing loss at the deafness, autosomal dominant non-syndromic sensorineural 10 locus. The encoded protein is also a putative oncogene that mediates DNA repair, apoptosis, and innate immunity following DNA damage, cellular damage, and viral attack. Defects in this gene are also associated with dilated cardiomyopathy 1J. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice show strain background-dependent postnatal lethality, reduced body weight, male sterility, a delay in palate bone fusion, developmental defects in the eustachian tube and middle ear cavity, early-onset hearing deficits, and profound susceptibility to otitis media with effusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh7a1 A G 18: 56,528,284 S492P probably damaging Het
Arfgef1 A T 1: 10,160,976 D1133E probably damaging Het
Avpi1 T C 19: 42,124,943 K25R probably damaging Het
Bank1 T C 3: 136,066,349 S708G probably damaging Het
C1qtnf2 A G 11: 43,490,967 E202G probably damaging Het
C6 T A 15: 4,808,488 V860E probably benign Het
Cbr1 T A 16: 93,609,810 V138E probably damaging Het
Cdip1 A G 16: 4,770,124 S2P probably damaging Het
Cep126 T C 9: 8,100,427 N702S probably damaging Het
Chek1 T C 9: 36,712,104 I381V probably benign Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cryz C T 3: 154,611,557 R138* probably null Het
Ctsll3 T A 13: 60,800,737 M103L probably benign Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 33,912,641 probably benign Het
Daxx CGATGATGATGA CGA 17: 33,912,659 probably benign Het
Dsg1a T G 18: 20,336,040 probably null Het
Flt1 T A 5: 147,655,138 S505C probably damaging Het
Gm11127 G A 17: 36,057,904 H95Y possibly damaging Het
Gpr161 C A 1: 165,306,413 F81L possibly damaging Het
Hmcn1 A G 1: 150,737,506 V1390A possibly damaging Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Klhl3 C T 13: 58,102,429 probably null Het
Lekr1 T A 3: 65,669,180 probably null Het
Lhx5 A G 5: 120,434,610 Q98R probably benign Het
Nuggc A G 14: 65,641,881 K681E possibly damaging Het
Numa1 G T 7: 102,013,930 A735S probably damaging Het
Olfr201 G A 16: 59,269,116 L184F probably benign Het
Oog3 A T 4: 144,158,028 L446Q probably benign Het
Otogl C T 10: 107,782,048 E1735K possibly damaging Het
Pcsk5 T C 19: 17,752,124 D119G probably benign Het
Pgpep1 T C 8: 70,652,419 K64E probably benign Het
Prr19 A C 7: 25,303,963 D334A probably damaging Het
Ptprh G T 7: 4,554,222 S691* probably null Het
Recql4 G A 15: 76,705,794 R684* probably null Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rnf40 T C 7: 127,589,130 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tdo2 T C 3: 81,958,940 R339G probably damaging Het
Tmem245 C T 4: 56,910,156 probably null Het
Trim24 A G 6: 37,965,550 E965G probably damaging Het
Trmt112 T C 19: 6,910,788 S103P probably damaging Het
Trpv6 A T 6: 41,636,154 V26D possibly damaging Het
Zfp850 A G 7: 27,989,419 C455R probably damaging Het
Zfp946 T C 17: 22,454,892 I209T probably benign Het
Zfp957 T C 14: 79,213,966 N131S probably benign Het
Other mutations in Eya4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Eya4 APN 10 23159097 missense probably benign 0.17
IGL00507:Eya4 APN 10 23157536 nonsense probably null
IGL01324:Eya4 APN 10 23116551 critical splice donor site probably null
IGL01350:Eya4 APN 10 23113974 missense possibly damaging 0.88
IGL01397:Eya4 APN 10 23139999 missense probably benign 0.01
IGL02682:Eya4 APN 10 23116600 missense probably damaging 1.00
IGL02688:Eya4 APN 10 23159110 missense probably benign 0.01
IGL03071:Eya4 APN 10 23323073 missense probably benign 0.07
R0420:Eya4 UTSW 10 23155963 missense possibly damaging 0.85
R1688:Eya4 UTSW 10 23123861 missense probably damaging 1.00
R2312:Eya4 UTSW 10 23106264 missense probably damaging 1.00
R3029:Eya4 UTSW 10 23123878 missense probably benign
R3853:Eya4 UTSW 10 23116676 missense probably damaging 1.00
R3872:Eya4 UTSW 10 23155972 missense probably damaging 0.97
R4113:Eya4 UTSW 10 23155951 missense probably damaging 0.98
R4210:Eya4 UTSW 10 23226800 critical splice donor site probably null
R4457:Eya4 UTSW 10 23116668 missense probably damaging 1.00
R4691:Eya4 UTSW 10 23140068 missense probably benign 0.03
R4894:Eya4 UTSW 10 23109854 missense possibly damaging 0.55
R5345:Eya4 UTSW 10 23110048 missense probably benign 0.00
R5473:Eya4 UTSW 10 23163453 missense probably benign 0.02
R5698:Eya4 UTSW 10 23140077 missense possibly damaging 0.50
R5951:Eya4 UTSW 10 23155994 missense probably damaging 1.00
R5953:Eya4 UTSW 10 23151973 missense probably damaging 1.00
R6111:Eya4 UTSW 10 23140055 missense possibly damaging 0.67
R6413:Eya4 UTSW 10 23116826 missense probably damaging 1.00
R6460:Eya4 UTSW 10 23152012 missense probably benign 0.05
R7144:Eya4 UTSW 10 23173045 missense probably benign 0.00
R7169:Eya4 UTSW 10 23155947 missense probably benign 0.42
R7358:Eya4 UTSW 10 23123851 critical splice donor site probably null
R7549:Eya4 UTSW 10 23111658 missense probably damaging 1.00
R7791:Eya4 UTSW 10 23113926 missense probably damaging 1.00
R7793:Eya4 UTSW 10 23226816 missense probably benign
Z1088:Eya4 UTSW 10 23113988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATTTGCAGGCCCACATCG -3'
(R):5'- TCAGGCAAGGAAAGCTGTTTTG -3'

Sequencing Primer
(F):5'- GGCCCACATCGACTCTCTCATG -3'
(R):5'- GTGTCCAGATTTGGCACTAAC -3'
Posted On2016-10-24