Incidental Mutation 'R5547:Nuggc'
ID436360
Institutional Source Beutler Lab
Gene Symbol Nuggc
Ensembl Gene ENSMUSG00000061356
Gene Namenuclear GTPase, germinal center associated
SynonymsGm600, SLIP-GC, LOC239151
MMRRC Submission 043105-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5547 (G1)
Quality Score113
Status Not validated
Chromosome14
Chromosomal Location65598546-65648531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65641881 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 681 (K681E)
Ref Sequence ENSEMBL: ENSMUSP00000118402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079469] [ENSMUST00000150897]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079469
AA Change: K697E

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078434
Gene: ENSMUSG00000061356
AA Change: K697E

DomainStartEndE-ValueType
Pfam:Dynamin_N 119 372 2.2e-15 PFAM
low complexity region 406 421 N/A INTRINSIC
Blast:AAA 434 739 4e-14 BLAST
coiled coil region 758 792 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150897
AA Change: K681E

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118402
Gene: ENSMUSG00000061356
AA Change: K681E

DomainStartEndE-ValueType
Pfam:Dynamin_N 103 356 6.1e-16 PFAM
low complexity region 390 405 N/A INTRINSIC
Blast:AAA 418 723 4e-14 BLAST
coiled coil region 742 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased somatic mutation frequency immunoglobulin and non-immunoglobulin loci in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh7a1 A G 18: 56,528,284 S492P probably damaging Het
Arfgef1 A T 1: 10,160,976 D1133E probably damaging Het
Avpi1 T C 19: 42,124,943 K25R probably damaging Het
Bank1 T C 3: 136,066,349 S708G probably damaging Het
C1qtnf2 A G 11: 43,490,967 E202G probably damaging Het
C6 T A 15: 4,808,488 V860E probably benign Het
Cbr1 T A 16: 93,609,810 V138E probably damaging Het
Cdip1 A G 16: 4,770,124 S2P probably damaging Het
Cep126 T C 9: 8,100,427 N702S probably damaging Het
Chek1 T C 9: 36,712,104 I381V probably benign Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cryz C T 3: 154,611,557 R138* probably null Het
Ctsll3 T A 13: 60,800,737 M103L probably benign Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 33,912,641 probably benign Het
Daxx CGATGATGATGA CGA 17: 33,912,659 probably benign Het
Dsg1a T G 18: 20,336,040 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Flt1 T A 5: 147,655,138 S505C probably damaging Het
Gm11127 G A 17: 36,057,904 H95Y possibly damaging Het
Gpr161 C A 1: 165,306,413 F81L possibly damaging Het
Hmcn1 A G 1: 150,737,506 V1390A possibly damaging Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Klhl3 C T 13: 58,102,429 probably null Het
Lekr1 T A 3: 65,669,180 probably null Het
Lhx5 A G 5: 120,434,610 Q98R probably benign Het
Numa1 G T 7: 102,013,930 A735S probably damaging Het
Olfr201 G A 16: 59,269,116 L184F probably benign Het
Oog3 A T 4: 144,158,028 L446Q probably benign Het
Otogl C T 10: 107,782,048 E1735K possibly damaging Het
Pcsk5 T C 19: 17,752,124 D119G probably benign Het
Pgpep1 T C 8: 70,652,419 K64E probably benign Het
Prr19 A C 7: 25,303,963 D334A probably damaging Het
Ptprh G T 7: 4,554,222 S691* probably null Het
Recql4 G A 15: 76,705,794 R684* probably null Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rnf40 T C 7: 127,589,130 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tdo2 T C 3: 81,958,940 R339G probably damaging Het
Tmem245 C T 4: 56,910,156 probably null Het
Trim24 A G 6: 37,965,550 E965G probably damaging Het
Trmt112 T C 19: 6,910,788 S103P probably damaging Het
Trpv6 A T 6: 41,636,154 V26D possibly damaging Het
Zfp850 A G 7: 27,989,419 C455R probably damaging Het
Zfp946 T C 17: 22,454,892 I209T probably benign Het
Zfp957 T C 14: 79,213,966 N131S probably benign Het
Other mutations in Nuggc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Nuggc APN 14 65623207 missense probably damaging 1.00
IGL01403:Nuggc APN 14 65623186 missense probably benign 0.01
IGL01413:Nuggc APN 14 65638581 missense probably benign 0.23
IGL02588:Nuggc APN 14 65617777 splice site probably benign
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0395:Nuggc UTSW 14 65613472 nonsense probably null
R0827:Nuggc UTSW 14 65608891 missense probably damaging 1.00
R1496:Nuggc UTSW 14 65624133 missense probably damaging 0.96
R1861:Nuggc UTSW 14 65642001 splice site probably benign
R1986:Nuggc UTSW 14 65641921 missense probably damaging 0.98
R1995:Nuggc UTSW 14 65611174 missense probably benign 0.02
R2283:Nuggc UTSW 14 65638612 missense possibly damaging 0.89
R2317:Nuggc UTSW 14 65624142 missense possibly damaging 0.81
R3799:Nuggc UTSW 14 65619638 missense probably benign 0.00
R3980:Nuggc UTSW 14 65619093 critical splice donor site probably null
R4303:Nuggc UTSW 14 65611172 missense possibly damaging 0.77
R4431:Nuggc UTSW 14 65611210 missense probably benign 0.19
R4734:Nuggc UTSW 14 65623230 missense probably damaging 1.00
R5095:Nuggc UTSW 14 65635090 nonsense probably null
R5108:Nuggc UTSW 14 65638680 missense probably damaging 0.99
R5360:Nuggc UTSW 14 65638626 missense probably damaging 1.00
R5636:Nuggc UTSW 14 65648188 nonsense probably null
R6494:Nuggc UTSW 14 65648222 missense probably damaging 1.00
R6922:Nuggc UTSW 14 65617643 missense probably damaging 1.00
R6971:Nuggc UTSW 14 65608856 missense probably benign 0.04
R7124:Nuggc UTSW 14 65608802 missense probably damaging 1.00
R7273:Nuggc UTSW 14 65619608 missense probably damaging 0.99
R7282:Nuggc UTSW 14 65617623 missense probably damaging 1.00
R7578:Nuggc UTSW 14 65648174 missense probably damaging 1.00
R7670:Nuggc UTSW 14 65613526 missense probably damaging 1.00
R7780:Nuggc UTSW 14 65645041 missense probably damaging 1.00
R7871:Nuggc UTSW 14 65623251 missense probably benign 0.01
R8250:Nuggc UTSW 14 65641869 missense probably benign 0.10
R8329:Nuggc UTSW 14 65641282 missense probably benign 0.01
R8334:Nuggc UTSW 14 65645029 missense probably benign 0.04
R8463:Nuggc UTSW 14 65613562 missense probably damaging 1.00
R8503:Nuggc UTSW 14 65641348 critical splice donor site probably null
R8737:Nuggc UTSW 14 65645086 missense probably benign 0.00
R8861:Nuggc UTSW 14 65610035 critical splice donor site probably null
R8914:Nuggc UTSW 14 65641905 missense probably benign
RF019:Nuggc UTSW 14 65648264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTGCTTGATTCAGTCAGTC -3'
(R):5'- GATGGCATCCAGCTCTACTG -3'

Sequencing Primer
(F):5'- CTGCTTGATTCAGTCAGTCCTTAGG -3'
(R):5'- GGCCCAGCTGTCTACCATCTG -3'
Posted On2016-10-24