Incidental Mutation 'R5547:Zfp957'
ID436361
Institutional Source Beutler Lab
Gene Symbol Zfp957
Ensembl Gene ENSMUSG00000071262
Gene Namezinc finger protein 957
SynonymsAU017455
MMRRC Submission 043105-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R5547 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location79212355-79247369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79213966 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 131 (N131S)
Ref Sequence ENSEMBL: ENSMUSP00000124930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040802] [ENSMUST00000161649]
Predicted Effect probably benign
Transcript: ENSMUST00000040802
AA Change: N131S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000039470
Gene: ENSMUSG00000071262
AA Change: N131S

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 29 53 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
AT_hook 255 267 4.76e0 SMART
AT_hook 298 310 4.76e0 SMART
AT_hook 348 360 2.48e0 SMART
low complexity region 390 398 N/A INTRINSIC
AT_hook 422 434 5.38e0 SMART
PHD 507 554 1.18e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161649
AA Change: N131S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000124930
Gene: ENSMUSG00000071262
AA Change: N131S

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 29 53 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
AT_hook 255 267 4.76e0 SMART
AT_hook 298 310 4.76e0 SMART
AT_hook 348 360 2.48e0 SMART
low complexity region 390 398 N/A INTRINSIC
AT_hook 422 434 5.38e0 SMART
PHD 507 554 1.18e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh7a1 A G 18: 56,528,284 S492P probably damaging Het
Arfgef1 A T 1: 10,160,976 D1133E probably damaging Het
Avpi1 T C 19: 42,124,943 K25R probably damaging Het
Bank1 T C 3: 136,066,349 S708G probably damaging Het
C1qtnf2 A G 11: 43,490,967 E202G probably damaging Het
C6 T A 15: 4,808,488 V860E probably benign Het
Cbr1 T A 16: 93,609,810 V138E probably damaging Het
Cdip1 A G 16: 4,770,124 S2P probably damaging Het
Cep126 T C 9: 8,100,427 N702S probably damaging Het
Chek1 T C 9: 36,712,104 I381V probably benign Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cryz C T 3: 154,611,557 R138* probably null Het
Ctsll3 T A 13: 60,800,737 M103L probably benign Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 33,912,641 probably benign Het
Daxx CGATGATGATGA CGA 17: 33,912,659 probably benign Het
Dsg1a T G 18: 20,336,040 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Flt1 T A 5: 147,655,138 S505C probably damaging Het
Gm11127 G A 17: 36,057,904 H95Y possibly damaging Het
Gpr161 C A 1: 165,306,413 F81L possibly damaging Het
Hmcn1 A G 1: 150,737,506 V1390A possibly damaging Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Klhl3 C T 13: 58,102,429 probably null Het
Lekr1 T A 3: 65,669,180 probably null Het
Lhx5 A G 5: 120,434,610 Q98R probably benign Het
Nuggc A G 14: 65,641,881 K681E possibly damaging Het
Numa1 G T 7: 102,013,930 A735S probably damaging Het
Olfr201 G A 16: 59,269,116 L184F probably benign Het
Oog3 A T 4: 144,158,028 L446Q probably benign Het
Otogl C T 10: 107,782,048 E1735K possibly damaging Het
Pcsk5 T C 19: 17,752,124 D119G probably benign Het
Pgpep1 T C 8: 70,652,419 K64E probably benign Het
Prr19 A C 7: 25,303,963 D334A probably damaging Het
Ptprh G T 7: 4,554,222 S691* probably null Het
Recql4 G A 15: 76,705,794 R684* probably null Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rnf40 T C 7: 127,589,130 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tdo2 T C 3: 81,958,940 R339G probably damaging Het
Tmem245 C T 4: 56,910,156 probably null Het
Trim24 A G 6: 37,965,550 E965G probably damaging Het
Trmt112 T C 19: 6,910,788 S103P probably damaging Het
Trpv6 A T 6: 41,636,154 V26D possibly damaging Het
Zfp850 A G 7: 27,989,419 C455R probably damaging Het
Zfp946 T C 17: 22,454,892 I209T probably benign Het
Other mutations in Zfp957
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Zfp957 APN 14 79213398 missense unknown
IGL01646:Zfp957 APN 14 79213891 missense probably benign 0.00
IGL02692:Zfp957 APN 14 79213385 missense unknown
R0632:Zfp957 UTSW 14 79212920 missense probably damaging 1.00
R1018:Zfp957 UTSW 14 79212742 missense probably damaging 1.00
R1719:Zfp957 UTSW 14 79213996 missense probably damaging 1.00
R2165:Zfp957 UTSW 14 79213613 missense probably benign 0.06
R2411:Zfp957 UTSW 14 79214342 missense unknown
R2517:Zfp957 UTSW 14 79214054 missense probably damaging 0.99
R3195:Zfp957 UTSW 14 79212892 missense probably damaging 1.00
R4825:Zfp957 UTSW 14 79214356 start codon destroyed probably null
R4881:Zfp957 UTSW 14 79213409 missense unknown
R5138:Zfp957 UTSW 14 79212922 missense probably damaging 1.00
R5174:Zfp957 UTSW 14 79213388 missense unknown
R5531:Zfp957 UTSW 14 79213182 missense unknown
R5677:Zfp957 UTSW 14 79212767 missense probably damaging 1.00
R5968:Zfp957 UTSW 14 79214056 missense probably damaging 1.00
R6897:Zfp957 UTSW 14 79213904 missense probably damaging 0.98
R6994:Zfp957 UTSW 14 79213690 missense probably damaging 0.99
R7105:Zfp957 UTSW 14 79212962 missense probably benign 0.09
R7214:Zfp957 UTSW 14 79213310 missense unknown
R7264:Zfp957 UTSW 14 79213640 missense probably damaging 0.98
Z1176:Zfp957 UTSW 14 79214138 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATTCTTCGGAAGAGTGGCTG -3'
(R):5'- TTGTAGACCCTCAAGAACCGG -3'

Sequencing Primer
(F):5'- GGATAATTTTGGGGATAAAAGGGTCC -3'
(R):5'- GGAGATCAAGCTAAAGTACGCTACC -3'
Posted On2016-10-24