Incidental Mutation 'R5547:Olfr201'
ID436365
Institutional Source Beutler Lab
Gene Symbol Olfr201
Ensembl Gene ENSMUSG00000074995
Gene Nameolfactory receptor 201
SynonymsGA_x54KRFPKG5P-55483936-55483010, MOR182-2
MMRRC Submission 043105-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5547 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location59266113-59272632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59269116 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 184 (L184F)
Ref Sequence ENSEMBL: ENSMUSP00000150660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099656] [ENSMUST00000216834]
Predicted Effect probably benign
Transcript: ENSMUST00000099656
AA Change: L184F

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097248
Gene: ENSMUSG00000074995
AA Change: L184F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7tm_1 41 290 8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216834
AA Change: L184F

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh7a1 A G 18: 56,528,284 S492P probably damaging Het
Arfgef1 A T 1: 10,160,976 D1133E probably damaging Het
Avpi1 T C 19: 42,124,943 K25R probably damaging Het
Bank1 T C 3: 136,066,349 S708G probably damaging Het
C1qtnf2 A G 11: 43,490,967 E202G probably damaging Het
C6 T A 15: 4,808,488 V860E probably benign Het
Cbr1 T A 16: 93,609,810 V138E probably damaging Het
Cdip1 A G 16: 4,770,124 S2P probably damaging Het
Cep126 T C 9: 8,100,427 N702S probably damaging Het
Chek1 T C 9: 36,712,104 I381V probably benign Het
Clock G A 5: 76,230,338 P572S probably benign Het
Cryz C T 3: 154,611,557 R138* probably null Het
Ctsll3 T A 13: 60,800,737 M103L probably benign Het
Daxx TGATGATGACGATGATGACGATGATGA TGATGATGACGATGATGA 17: 33,912,641 probably benign Het
Daxx CGATGATGATGA CGA 17: 33,912,659 probably benign Het
Dsg1a T G 18: 20,336,040 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Flt1 T A 5: 147,655,138 S505C probably damaging Het
Gm11127 G A 17: 36,057,904 H95Y possibly damaging Het
Gpr161 C A 1: 165,306,413 F81L possibly damaging Het
Hmcn1 A G 1: 150,737,506 V1390A possibly damaging Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Klhl3 C T 13: 58,102,429 probably null Het
Lekr1 T A 3: 65,669,180 probably null Het
Lhx5 A G 5: 120,434,610 Q98R probably benign Het
Nuggc A G 14: 65,641,881 K681E possibly damaging Het
Numa1 G T 7: 102,013,930 A735S probably damaging Het
Oog3 A T 4: 144,158,028 L446Q probably benign Het
Otogl C T 10: 107,782,048 E1735K possibly damaging Het
Pcsk5 T C 19: 17,752,124 D119G probably benign Het
Pgpep1 T C 8: 70,652,419 K64E probably benign Het
Prr19 A C 7: 25,303,963 D334A probably damaging Het
Ptprh G T 7: 4,554,222 S691* probably null Het
Recql4 G A 15: 76,705,794 R684* probably null Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rnf40 T C 7: 127,589,130 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tdo2 T C 3: 81,958,940 R339G probably damaging Het
Tmem245 C T 4: 56,910,156 probably null Het
Trim24 A G 6: 37,965,550 E965G probably damaging Het
Trmt112 T C 19: 6,910,788 S103P probably damaging Het
Trpv6 A T 6: 41,636,154 V26D possibly damaging Het
Zfp850 A G 7: 27,989,419 C455R probably damaging Het
Zfp946 T C 17: 22,454,892 I209T probably benign Het
Zfp957 T C 14: 79,213,966 N131S probably benign Het
Other mutations in Olfr201
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Olfr201 APN 16 59268850 missense probably benign 0.07
IGL01985:Olfr201 APN 16 59269079 missense probably benign
IGL02618:Olfr201 APN 16 59268927 missense probably damaging 1.00
IGL02830:Olfr201 APN 16 59269053 missense possibly damaging 0.94
PIT4449001:Olfr201 UTSW 16 59269130 missense probably damaging 1.00
R0047:Olfr201 UTSW 16 59269211 missense probably damaging 1.00
R0047:Olfr201 UTSW 16 59269211 missense probably damaging 1.00
R1035:Olfr201 UTSW 16 59268944 missense probably damaging 1.00
R1037:Olfr201 UTSW 16 59268944 missense probably damaging 1.00
R1163:Olfr201 UTSW 16 59269155 missense probably benign 0.23
R1225:Olfr201 UTSW 16 59269224 missense probably benign
R1519:Olfr201 UTSW 16 59268944 missense probably damaging 1.00
R1583:Olfr201 UTSW 16 59269031 missense probably benign 0.00
R2075:Olfr201 UTSW 16 59268911 missense possibly damaging 0.60
R4591:Olfr201 UTSW 16 59269413 missense possibly damaging 0.94
R6132:Olfr201 UTSW 16 59269004 missense probably damaging 0.97
R6737:Olfr201 UTSW 16 59268812 missense possibly damaging 0.60
R6872:Olfr201 UTSW 16 59269598 missense probably benign 0.20
R8001:Olfr201 UTSW 16 59269109 missense probably benign 0.01
R8525:Olfr201 UTSW 16 59269208 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GTAGAGAAGGCTTTGCTTCTGC -3'
(R):5'- GTGCAACCACGGAATGCTTTC -3'

Sequencing Primer
(F):5'- GCCCTTTTCAGACTTCTTTCTCAGG -3'
(R):5'- GATGGCCTATGACCGCTATCTG -3'
Posted On2016-10-24