Incidental Mutation 'R5558:Slc30a4'
ID436382
Institutional Source Beutler Lab
Gene Symbol Slc30a4
Ensembl Gene ENSMUSG00000005802
Gene Namesolute carrier family 30 (zinc transporter), member 4
SynonymsZnt4
MMRRC Submission 043115-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5558 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location122681233-122702663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122686983 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 324 (I324T)
Ref Sequence ENSEMBL: ENSMUSP00000005952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005952] [ENSMUST00000099457]
Predicted Effect probably damaging
Transcript: ENSMUST00000005952
AA Change: I324T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005952
Gene: ENSMUSG00000005802
AA Change: I324T

DomainStartEndE-ValueType
low complexity region 67 83 N/A INTRINSIC
Pfam:Cation_efflux 114 333 1.3e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099457
AA Change: I275T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097056
Gene: ENSMUSG00000005802
AA Change: I275T

DomainStartEndE-ValueType
low complexity region 67 83 N/A INTRINSIC
Pfam:Cation_efflux 124 368 4.6e-46 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is the second most abundant trace metal in the human body. It is an essential element, serving both a structural role, as in the formation of zinc fingers in DNA-binding proteins, and a catalytic role in metalloenzymes, such as pancreatic carboxypeptidases (e.g., MIM 114852), alkaline phosphatases (e.g., MIM 171760), various dehydrogenases, and superoxide dismutases (e.g., MIM 147450). SLC30A4, or ZNT4, belongs to the ZNT family of zinc transporters. ZNTs are involved in transporting zinc out of the cytoplasm and have similar structures, consisting of 6 transmembrane domains and a histidine-rich cytoplasmic loop (Huang and Gitschier, 1997 [PubMed 9354792]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant dams produce zinc-deficient milk that is lethal to all nursing pups. Pleiotropic defects observed in mutant males and females include otolith degeneration, impaired motor coordination, alopecia, and dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A C 3: 88,693,096 H164P probably damaging Het
Abcg4 T C 9: 44,281,408 K177E probably damaging Het
Acvr1 T C 2: 58,459,017 T378A probably damaging Het
Agtpbp1 A G 13: 59,482,580 V779A probably benign Het
Alms1 C T 6: 85,641,329 Q2786* probably null Het
Arhgef28 A C 13: 97,961,460 L882R probably damaging Het
Cbx2 A G 11: 119,028,949 T447A probably benign Het
Ch25h A G 19: 34,474,463 W222R probably damaging Het
Chsy3 T G 18: 59,176,397 S241A probably damaging Het
Cyfip1 T C 7: 55,892,001 S345P possibly damaging Het
Cyp4a30b C A 4: 115,458,866 D291E probably damaging Het
Dcstamp A G 15: 39,759,540 Y419C probably damaging Het
Eif3d G A 15: 77,961,847 R359C probably damaging Het
Elavl4 C A 4: 110,206,603 G267V probably benign Het
Gars T C 6: 55,065,607 S442P probably damaging Het
Gas6 C T 8: 13,466,764 R578Q probably null Het
Hist1h4d C A 13: 23,581,796 N65K possibly damaging Het
Ifitm6 T C 7: 141,016,072 I103V probably benign Het
Igsf5 T A 16: 96,386,531 I241N possibly damaging Het
Iqce A G 5: 140,671,805 probably null Het
Kif20b C A 19: 34,951,549 Q1192K probably damaging Het
Lap3 A G 5: 45,504,751 N298D probably benign Het
Lca5 A T 9: 83,401,743 S246T probably damaging Het
Mrps5 G A 2: 127,602,435 G330S probably damaging Het
Myh15 C T 16: 49,069,537 R164C probably benign Het
Myo19 C G 11: 84,910,448 P940R probably damaging Het
Olfr1406 T C 1: 173,184,018 R139G probably benign Het
Olfr1445 T C 19: 12,884,387 F169L probably benign Het
Pcdh10 A G 3: 45,384,168 D920G probably damaging Het
Pgm5 A T 19: 24,824,451 probably null Het
Phactr4 T C 4: 132,378,455 E137G probably damaging Het
Pkn1 C T 8: 83,684,722 V239M probably damaging Het
Plcz1 T A 6: 140,039,755 D20V probably damaging Het
Prkca A T 11: 107,981,647 I429N probably damaging Het
Ptk2 A T 15: 73,304,445 Y251N probably damaging Het
R3hdm2 T C 10: 127,444,402 F31S probably damaging Het
Rab11fip1 T A 8: 27,151,975 E932V probably damaging Het
Rilp A G 11: 75,511,425 Y250C probably damaging Het
Sclt1 A G 3: 41,661,590 I474T probably benign Het
Slc14a2 T A 18: 78,159,166 D583V possibly damaging Het
Slc6a5 G A 7: 49,927,573 V326I probably benign Het
Slco1c1 C T 6: 141,567,496 T617I probably damaging Het
Sntg1 A G 1: 8,414,271 S442P possibly damaging Het
Sys1 G T 2: 164,464,509 A128S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmed5 A G 5: 108,124,596 I212T probably benign Het
Tnks T C 8: 34,965,665 M1V probably null Het
Trpa1 T C 1: 14,898,268 H452R probably damaging Het
Trpm3 T C 19: 22,978,573 V1133A probably damaging Het
Ttn T A 2: 76,725,051 I30537F probably damaging Het
Ush2a T C 1: 188,797,827 V3271A possibly damaging Het
Utp20 C G 10: 88,751,467 G2489R probably damaging Het
Vmn1r70 A T 7: 10,634,475 S278C probably benign Het
Wdpcp G A 11: 21,711,732 A335T probably benign Het
Zc3h18 G T 8: 122,386,920 R217L probably damaging Het
Zfp384 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 6: 125,036,509 probably benign Het
Zfp955b C T 17: 33,302,187 T210I possibly damaging Het
Other mutations in Slc30a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Slc30a4 APN 2 122702388 missense possibly damaging 0.87
IGL01583:Slc30a4 APN 2 122685217 missense probably benign
IGL01823:Slc30a4 APN 2 122702092 missense probably damaging 1.00
IGL02086:Slc30a4 APN 2 122702027 splice site probably benign
F5770:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
R0060:Slc30a4 UTSW 2 122685184 missense probably benign
R0060:Slc30a4 UTSW 2 122685184 missense probably benign
R0373:Slc30a4 UTSW 2 122689399 missense probably damaging 0.99
R0591:Slc30a4 UTSW 2 122685240 missense probably damaging 1.00
R1514:Slc30a4 UTSW 2 122689414 missense probably damaging 1.00
R1552:Slc30a4 UTSW 2 122686016 missense probably benign 0.05
R3847:Slc30a4 UTSW 2 122702272 missense probably damaging 1.00
R4195:Slc30a4 UTSW 2 122685270 missense probably damaging 1.00
R4501:Slc30a4 UTSW 2 122685216 missense probably benign
R6379:Slc30a4 UTSW 2 122689549 missense probably damaging 1.00
R6393:Slc30a4 UTSW 2 122686046 missense probably damaging 1.00
R7394:Slc30a4 UTSW 2 122685304 missense possibly damaging 0.93
V7580:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
V7581:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
V7582:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
V7583:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTAACTAGCCTAGCTCACCTG -3'
(R):5'- TCCTGATAAAGAGAACAGAGACCTG -3'

Sequencing Primer
(F):5'- TGCTTTACCCGCTGAAAGG -3'
(R):5'- GACCTGTGTCTTGCTCCACTTTATAG -3'
Posted On2016-10-24