Incidental Mutation 'R5558:Pcdh10'
ID436387
Institutional Source Beutler Lab
Gene Symbol Pcdh10
Ensembl Gene ENSMUSG00000049100
Gene Nameprotocadherin 10
Synonyms6430521D13Rik, OL-pc, 6430703F07Rik
MMRRC Submission 043115-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R5558 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location45378398-45435623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45384168 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 920 (D920G)
Ref Sequence ENSEMBL: ENSMUSP00000131600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166126] [ENSMUST00000170695] [ENSMUST00000171554] [ENSMUST00000193252]
Predicted Effect probably damaging
Transcript: ENSMUST00000166126
AA Change: D920G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131073
Gene: ENSMUSG00000049100
AA Change: D920G

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
Pfam:Cadherin_C_2 713 838 5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170695
AA Change: D920G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132769
Gene: ENSMUSG00000049100
AA Change: D920G

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171554
AA Change: D920G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131600
Gene: ENSMUSG00000049100
AA Change: D920G

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193252
SMART Domains Protein: ENSMUSP00000141529
Gene: ENSMUSG00000049100

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
low complexity region 887 896 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195655
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This family member contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein is a cadherin-related neuronal receptor thought to function in the establishment of specific cell-cell connections in the brain. This gene plays a role in inhibiting cancer cell motility and cell migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele die within several weeks of birth and exhibit decreased body size and defective striatal axon growth and thalamocortical projections in the ventral telencephalon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A C 3: 88,693,096 H164P probably damaging Het
Abcg4 T C 9: 44,281,408 K177E probably damaging Het
Acvr1 T C 2: 58,459,017 T378A probably damaging Het
Agtpbp1 A G 13: 59,482,580 V779A probably benign Het
Alms1 C T 6: 85,641,329 Q2786* probably null Het
Arhgef28 A C 13: 97,961,460 L882R probably damaging Het
Cbx2 A G 11: 119,028,949 T447A probably benign Het
Ch25h A G 19: 34,474,463 W222R probably damaging Het
Chsy3 T G 18: 59,176,397 S241A probably damaging Het
Cyfip1 T C 7: 55,892,001 S345P possibly damaging Het
Cyp4a30b C A 4: 115,458,866 D291E probably damaging Het
Dcstamp A G 15: 39,759,540 Y419C probably damaging Het
Eif3d G A 15: 77,961,847 R359C probably damaging Het
Elavl4 C A 4: 110,206,603 G267V probably benign Het
Gars T C 6: 55,065,607 S442P probably damaging Het
Gas6 C T 8: 13,466,764 R578Q probably null Het
Hist1h4d C A 13: 23,581,796 N65K possibly damaging Het
Ifitm6 T C 7: 141,016,072 I103V probably benign Het
Igsf5 T A 16: 96,386,531 I241N possibly damaging Het
Iqce A G 5: 140,671,805 probably null Het
Kif20b C A 19: 34,951,549 Q1192K probably damaging Het
Lap3 A G 5: 45,504,751 N298D probably benign Het
Lca5 A T 9: 83,401,743 S246T probably damaging Het
Mrps5 G A 2: 127,602,435 G330S probably damaging Het
Myh15 C T 16: 49,069,537 R164C probably benign Het
Myo19 C G 11: 84,910,448 P940R probably damaging Het
Olfr1406 T C 1: 173,184,018 R139G probably benign Het
Olfr1445 T C 19: 12,884,387 F169L probably benign Het
Pgm5 A T 19: 24,824,451 probably null Het
Phactr4 T C 4: 132,378,455 E137G probably damaging Het
Pkn1 C T 8: 83,684,722 V239M probably damaging Het
Plcz1 T A 6: 140,039,755 D20V probably damaging Het
Prkca A T 11: 107,981,647 I429N probably damaging Het
Ptk2 A T 15: 73,304,445 Y251N probably damaging Het
R3hdm2 T C 10: 127,444,402 F31S probably damaging Het
Rab11fip1 T A 8: 27,151,975 E932V probably damaging Het
Rilp A G 11: 75,511,425 Y250C probably damaging Het
Sclt1 A G 3: 41,661,590 I474T probably benign Het
Slc14a2 T A 18: 78,159,166 D583V possibly damaging Het
Slc30a4 A G 2: 122,686,983 I324T probably damaging Het
Slc6a5 G A 7: 49,927,573 V326I probably benign Het
Slco1c1 C T 6: 141,567,496 T617I probably damaging Het
Sntg1 A G 1: 8,414,271 S442P possibly damaging Het
Sys1 G T 2: 164,464,509 A128S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmed5 A G 5: 108,124,596 I212T probably benign Het
Tnks T C 8: 34,965,665 M1V probably null Het
Trpa1 T C 1: 14,898,268 H452R probably damaging Het
Trpm3 T C 19: 22,978,573 V1133A probably damaging Het
Ttn T A 2: 76,725,051 I30537F probably damaging Het
Ush2a T C 1: 188,797,827 V3271A possibly damaging Het
Utp20 C G 10: 88,751,467 G2489R probably damaging Het
Vmn1r70 A T 7: 10,634,475 S278C probably benign Het
Wdpcp G A 11: 21,711,732 A335T probably benign Het
Zc3h18 G T 8: 122,386,920 R217L probably damaging Het
Zfp384 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 6: 125,036,509 probably benign Het
Zfp955b C T 17: 33,302,187 T210I possibly damaging Het
Other mutations in Pcdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Pcdh10 APN 3 45380302 missense probably damaging 1.00
IGL01115:Pcdh10 APN 3 45392775 missense probably damaging 1.00
IGL01535:Pcdh10 APN 3 45379643 missense probably damaging 1.00
IGL01600:Pcdh10 APN 3 45379487 missense probably damaging 0.98
IGL01625:Pcdh10 APN 3 45379397 missense probably damaging 0.99
IGL01966:Pcdh10 APN 3 45380298 missense probably benign 0.05
IGL02232:Pcdh10 APN 3 45380942 missense probably benign 0.00
IGL02490:Pcdh10 APN 3 45380487 missense probably damaging 1.00
IGL02890:Pcdh10 APN 3 45392617 missense probably damaging 1.00
IGL02976:Pcdh10 APN 3 45380013 missense possibly damaging 0.92
IGL02997:Pcdh10 APN 3 45379362 missense probably damaging 1.00
IGL03006:Pcdh10 APN 3 45379502 missense probably damaging 0.99
IGL03385:Pcdh10 APN 3 45381512 missense possibly damaging 0.77
R0025:Pcdh10 UTSW 3 45380499 missense possibly damaging 0.93
R0157:Pcdh10 UTSW 3 45379701 missense probably damaging 1.00
R0372:Pcdh10 UTSW 3 45379497 missense probably damaging 1.00
R0652:Pcdh10 UTSW 3 45379764 missense probably damaging 1.00
R0760:Pcdh10 UTSW 3 45380570 missense probably benign 0.19
R0976:Pcdh10 UTSW 3 45380801 missense probably damaging 1.00
R1307:Pcdh10 UTSW 3 45381879 missense probably benign 0.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1510:Pcdh10 UTSW 3 45379403 missense probably damaging 1.00
R1619:Pcdh10 UTSW 3 45380312 missense possibly damaging 0.94
R1678:Pcdh10 UTSW 3 45381881 nonsense probably null
R1687:Pcdh10 UTSW 3 45380015 missense probably damaging 1.00
R1750:Pcdh10 UTSW 3 45381881 nonsense probably null
R1751:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1767:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1857:Pcdh10 UTSW 3 45379937 missense possibly damaging 0.86
R2086:Pcdh10 UTSW 3 45380471 missense probably damaging 0.98
R3960:Pcdh10 UTSW 3 45379314 missense probably benign
R4083:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4084:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4112:Pcdh10 UTSW 3 45381620 missense probably damaging 1.00
R4754:Pcdh10 UTSW 3 45380637 missense probably damaging 0.99
R4946:Pcdh10 UTSW 3 45379482 missense probably damaging 1.00
R5039:Pcdh10 UTSW 3 45381861 missense probably damaging 1.00
R5224:Pcdh10 UTSW 3 45392814 missense probably damaging 0.99
R5233:Pcdh10 UTSW 3 45384191 missense probably damaging 1.00
R5261:Pcdh10 UTSW 3 45381812 missense probably damaging 1.00
R5429:Pcdh10 UTSW 3 45384200 missense probably benign 0.00
R5488:Pcdh10 UTSW 3 45381368 missense probably damaging 1.00
R5784:Pcdh10 UTSW 3 45380640 missense probably damaging 1.00
R5815:Pcdh10 UTSW 3 45392721 missense probably benign 0.04
R6283:Pcdh10 UTSW 3 45381554 missense possibly damaging 0.46
R6396:Pcdh10 UTSW 3 45380060 missense possibly damaging 0.46
R6703:Pcdh10 UTSW 3 45381299 missense possibly damaging 0.87
R6756:Pcdh10 UTSW 3 45380106 missense possibly damaging 0.80
R6968:Pcdh10 UTSW 3 45379542 missense probably damaging 1.00
R7463:Pcdh10 UTSW 3 45383572 missense possibly damaging 0.59
R7574:Pcdh10 UTSW 3 45381375 missense possibly damaging 0.92
R7691:Pcdh10 UTSW 3 45381197 missense probably damaging 1.00
R7795:Pcdh10 UTSW 3 45380222 missense probably benign 0.09
R8057:Pcdh10 UTSW 3 45379259 missense probably benign 0.00
R8082:Pcdh10 UTSW 3 45381744 missense probably damaging 1.00
R8302:Pcdh10 UTSW 3 45381498 missense probably damaging 0.99
X0013:Pcdh10 UTSW 3 45379566 missense probably damaging 1.00
Z1177:Pcdh10 UTSW 3 45381729 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAAGAGTCTGCAGCACACATTAG -3'
(R):5'- GCATGGTGTTTAGATTCTAGAGTACAG -3'

Sequencing Primer
(F):5'- ATTAGTGACCATGTGGTGG -3'
(R):5'- TCTAGAGTACAGTTCTAACCTCAAC -3'
Posted On2016-10-24