Mutagenetix > Incidental Mutation

Incidental Mutation 'R0006:Nav2'

43639

Institutional Source

Beutler Lab

Gene Symbol

Nav2

Ensembl Gene

ENSMUSG00000052512

Gene Name

neuron navigator 2

Synonyms

Rainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2

MMRRC Submission

041980-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.705) question?

Stock #

R0006 (G1)

Quality Score

186

Status

Validated

Chromosome

Chromosomal Location

48908716-49610090 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 49453230 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 531 (E531G)

Ref Sequence

ENSEMBL: ENSMUSP00000139309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184124] [ENSMUST00000184945]

AlphaFold

E9Q842

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000064383

SMART Domains

Protein: ENSMUSP00000066835
Gene: ENSMUSG00000052512

Domain	Start	End	E-Value	Type
Blast:CH	18	79	2e-35	BLAST
PDB:2YRN\|A	18	80	3e-33	PDB
SCOP:d1dxxa1	29	81	4e-15	SMART
low complexity region	94	102	N/A	INTRINSIC
low complexity region	189	202	N/A	INTRINSIC
low complexity region	229	240	N/A	INTRINSIC
low complexity region	304	316	N/A	INTRINSIC
coiled coil region	378	408	N/A	INTRINSIC
low complexity region	472	483	N/A	INTRINSIC
low complexity region	505	517	N/A	INTRINSIC
low complexity region	532	554	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064395
AA Change: E592G

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: E592G

Domain	Start	End	E-Value	Type
CH	84	187	1.58e-13	SMART
low complexity region	202	210	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
low complexity region	412	424	N/A	INTRINSIC
coiled coil region	486	516	N/A	INTRINSIC
low complexity region	580	591	N/A	INTRINSIC
low complexity region	613	625	N/A	INTRINSIC
low complexity region	640	662	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	920	944	N/A	INTRINSIC
low complexity region	947	967	N/A	INTRINSIC
low complexity region	990	1004	N/A	INTRINSIC
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1343	1360	N/A	INTRINSIC
low complexity region	1368	1385	N/A	INTRINSIC
low complexity region	1417	1432	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1614	1628	N/A	INTRINSIC
coiled coil region	1630	1717	N/A	INTRINSIC
low complexity region	1789	1800	N/A	INTRINSIC
coiled coil region	1841	1909	N/A	INTRINSIC
AAA	2093	2247	1.69e-5	SMART
low complexity region	2404	2430	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000183659
AA Change: E531G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: E531G

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
CH	23	126	6.19e-16	SMART
low complexity region	141	149	N/A	INTRINSIC
low complexity region	236	249	N/A	INTRINSIC
low complexity region	276	287	N/A	INTRINSIC
low complexity region	351	363	N/A	INTRINSIC
coiled coil region	425	455	N/A	INTRINSIC
low complexity region	519	530	N/A	INTRINSIC
low complexity region	552	564	N/A	INTRINSIC
low complexity region	579	601	N/A	INTRINSIC
low complexity region	785	796	N/A	INTRINSIC
low complexity region	859	883	N/A	INTRINSIC
low complexity region	886	906	N/A	INTRINSIC
low complexity region	929	943	N/A	INTRINSIC
low complexity region	1001	1013	N/A	INTRINSIC
low complexity region	1282	1299	N/A	INTRINSIC
low complexity region	1307	1324	N/A	INTRINSIC
low complexity region	1356	1371	N/A	INTRINSIC
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1465	1479	N/A	INTRINSIC
low complexity region	1553	1567	N/A	INTRINSIC
coiled coil region	1569	1656	N/A	INTRINSIC
low complexity region	1728	1739	N/A	INTRINSIC
coiled coil region	1780	1848	N/A	INTRINSIC
AAA	2032	2186	1.69e-5	SMART
low complexity region	2343	2369	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000184124

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184155

Predicted Effect

probably benign
Transcript: ENSMUST00000184945
AA Change: E592G

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: E592G

Domain	Start	End	E-Value	Type
CH	84	187	1.58e-13	SMART
low complexity region	202	210	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
low complexity region	412	424	N/A	INTRINSIC
coiled coil region	486	516	N/A	INTRINSIC
low complexity region	580	591	N/A	INTRINSIC
low complexity region	613	625	N/A	INTRINSIC
low complexity region	640	662	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	920	944	N/A	INTRINSIC
low complexity region	947	967	N/A	INTRINSIC
low complexity region	990	1004	N/A	INTRINSIC
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1343	1360	N/A	INTRINSIC
low complexity region	1368	1385	N/A	INTRINSIC
low complexity region	1417	1432	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1614	1628	N/A	INTRINSIC
coiled coil region	1630	1717	N/A	INTRINSIC
low complexity region	1789	1800	N/A	INTRINSIC
coiled coil region	1841	1909	N/A	INTRINSIC
AAA	2093	2247	1.69e-5	SMART
low complexity region	2404	2430	N/A	INTRINSIC

Meta Mutation Damage Score

0.0646

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.4%
20x: 93.3%

Validation Efficiency

97% (67/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp1	A	G	11: 5,863,935		probably benign	Het
Aldh3a1	G	A	11: 61,217,101	V324M	probably damaging	Het
Als2cl	T	A	9: 110,894,618	L694Q	possibly damaging	Het
Appl2	A	G	10: 83,602,898	F556L	probably damaging	Het
Atad2b	T	A	12: 4,942,030	S210T	possibly damaging	Het
Aurka	A	G	2: 172,359,753		probably null	Het
Boc	C	T	16: 44,496,449	V444I	probably benign	Het
Cfap61	G	A	2: 146,077,312	V655I	probably benign	Het
Chd8	A	G	14: 52,235,293	I351T	possibly damaging	Het
Chid1	T	A	7: 141,496,426		probably benign	Het
Cyp3a41a	T	A	5: 145,704,796	H288L	probably benign	Het
Dnase2b	T	A	3: 146,582,489	I284F	probably damaging	Het
Dock2	A	G	11: 34,312,453		probably benign	Het
Dst	C	T	1: 34,228,918	T5325I	probably benign	Het
Erbb3	A	G	10: 128,573,410		probably null	Het
Fam129c	A	G	8: 71,605,044		probably benign	Het
Fancl	A	G	11: 26,469,695	N316S	possibly damaging	Het
Farsa	G	T	8: 84,861,305		probably benign	Het
Fibcd1	T	G	2: 31,838,587	D86A	probably damaging	Het
Gab1	A	T	8: 80,769,730	M617K	possibly damaging	Het
Gabrd	C	A	4: 155,388,601	V72L	probably damaging	Het
Ggh	C	A	4: 20,054,155	T150K	possibly damaging	Het
Gm340	A	G	19: 41,584,899	T698A	probably benign	Het
Gnb3	G	A	6: 124,835,804		probably benign	Het
Hephl1	T	A	9: 15,076,764	T683S	probably benign	Het
Hmcn1	G	A	1: 150,808,676	P381L	probably damaging	Het
Hspa8	T	G	9: 40,804,629	N544K	probably benign	Het
Hspg2	C	T	4: 137,519,931	T1155I	probably damaging	Het
Igdcc4	C	T	9: 65,135,100		probably benign	Het
Jazf1	A	G	6: 52,894,086		probably benign	Het
Kntc1	T	A	5: 123,789,138	S1219T	probably benign	Het
L3mbtl1	A	T	2: 162,964,569	Y460F	possibly damaging	Het
Lyrm7	T	A	11: 54,848,597	T76S	probably benign	Het
Map1b	C	T	13: 99,435,302	V304M	probably damaging	Het
Mcub	A	C	3: 129,933,765		probably benign	Het
Muc13	T	C	16: 33,803,148	S271P	probably damaging	Het
Myo16	A	G	8: 10,475,988	K843E	probably damaging	Het
Nup188	T	C	2: 30,322,023	V553A	probably benign	Het
Olfr1	A	G	11: 73,395,488	F178S	probably damaging	Het
Olfr1348	A	G	7: 6,501,611	I205T	possibly damaging	Het
Olfr376	A	G	11: 73,375,588	M283V	possibly damaging	Het
Olfr646	A	G	7: 104,106,320	I14V	probably benign	Het
Olfr877	T	A	9: 37,855,220	V134D	possibly damaging	Het
P4ha3	C	T	7: 100,318,948	R378*	probably null	Het
Rap1gds1	G	T	3: 138,983,871		probably null	Het
Rbfox1	T	A	16: 7,330,420	S244R	probably benign	Het
Rpp40	G	A	13: 35,896,735	P339S	probably damaging	Het
Rsph4a	T	C	10: 33,909,148	C148R	probably damaging	Het
Skint5	T	C	4: 113,893,862		probably benign	Het
Sptbn1	A	G	11: 30,123,855	S1405P	probably damaging	Het
Tex35	T	C	1: 157,099,744	K154E	possibly damaging	Het
Thada	T	C	17: 84,226,040	N1661S	probably benign	Het
Tle4	A	G	19: 14,466,714		probably benign	Het
Tnxb	T	C	17: 34,682,292	S1027P	probably benign	Het
Tpm3	T	A	3: 90,087,661		probably benign	Het
Ubr4	T	C	4: 139,431,649	F2438L	probably benign	Het
Uggt2	A	T	14: 119,049,663	F640L	probably benign	Het
Vmn1r20	T	G	6: 57,432,305	H205Q	probably damaging	Het
Wbp2	T	C	11: 116,079,788		probably null	Het
Xirp1	T	C	9: 120,017,454	I788V	probably benign	Het
Zc3hav1	A	G	6: 38,319,702		probably null	Het
Zfp687	A	G	3: 95,011,456	I335T	probably damaging	Het
Zfpm1	A	G	8: 122,334,488	Y264C	probably damaging	Het

Other mutations in Nav2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01097:Nav2	APN	7	49571194	missense	probably damaging	1.00
IGL01150:Nav2	APN	7	49452521	missense	probably benign	0.17
IGL01649:Nav2	APN	7	49575729	missense	probably damaging	1.00
IGL01662:Nav2	APN	7	49571209	missense	probably damaging	1.00
IGL02297:Nav2	APN	7	49594229	missense	probably damaging	0.98
IGL02313:Nav2	APN	7	49558773	missense	probably damaging	0.99
IGL02441:Nav2	APN	7	49452512	missense	probably damaging	1.00
IGL02472:Nav2	APN	7	49546041	missense	probably damaging	1.00
IGL02477:Nav2	APN	7	49582875	missense	probably damaging	0.99
IGL02725:Nav2	APN	7	49565095	missense	probably damaging	1.00
IGL02944:Nav2	APN	7	49420256	missense	probably damaging	0.99
IGL02953:Nav2	APN	7	49548423	missense	probably damaging	1.00
IGL03105:Nav2	APN	7	49464879	missense	probably damaging	1.00
IGL03234:Nav2	APN	7	49462008	missense	possibly damaging	0.94
IGL03274:Nav2	APN	7	49362099	missense	probably damaging	1.00
IGL03294:Nav2	APN	7	49491457	nonsense	probably null
R0070:Nav2	UTSW	7	49570714	missense	probably damaging	1.00
R0113:Nav2	UTSW	7	49535953	missense	probably damaging	1.00
R0306:Nav2	UTSW	7	49545903	missense	probably benign	0.01
R0346:Nav2	UTSW	7	49604585	missense	probably benign	0.11
R0539:Nav2	UTSW	7	49461938	missense	probably damaging	1.00
R0669:Nav2	UTSW	7	49408683	missense	probably damaging	1.00
R0785:Nav2	UTSW	7	49420333	missense	probably benign	0.06
R0970:Nav2	UTSW	7	49584153	missense	probably damaging	1.00
R1162:Nav2	UTSW	7	49536040	splice site	probably benign
R1274:Nav2	UTSW	7	49604430	nonsense	probably null
R1463:Nav2	UTSW	7	49535962	missense	probably damaging	1.00
R1464:Nav2	UTSW	7	49362204	missense	probably damaging	1.00
R1464:Nav2	UTSW	7	49362204	missense	probably damaging	1.00
R1536:Nav2	UTSW	7	49545934	missense	probably damaging	1.00
R1612:Nav2	UTSW	7	49571211	missense	probably damaging	1.00
R1638:Nav2	UTSW	7	49452465	missense	probably benign
R1731:Nav2	UTSW	7	49548174	missense	probably damaging	1.00
R1734:Nav2	UTSW	7	49575720	missense	probably damaging	1.00
R1865:Nav2	UTSW	7	49548195	missense	possibly damaging	0.95
R1945:Nav2	UTSW	7	49464872	missense	probably damaging	1.00
R1997:Nav2	UTSW	7	49548471	missense	probably benign	0.16
R2061:Nav2	UTSW	7	49598897	splice site	probably benign
R2117:Nav2	UTSW	7	49464580	missense	probably benign	0.00
R2174:Nav2	UTSW	7	49452663	missense	probably damaging	0.99
R2182:Nav2	UTSW	7	49597254	missense	probably benign	0.38
R2251:Nav2	UTSW	7	49453277	missense	probably damaging	1.00
R2283:Nav2	UTSW	7	49491404	missense	probably damaging	1.00
R2343:Nav2	UTSW	7	49598817	missense	possibly damaging	0.82
R2472:Nav2	UTSW	7	49408884	missense	probably benign
R2568:Nav2	UTSW	7	49597564	missense	probably damaging	1.00
R2656:Nav2	UTSW	7	49545942	missense	probably damaging	1.00
R2964:Nav2	UTSW	7	49557032	missense	probably damaging	1.00
R2966:Nav2	UTSW	7	49557032	missense	probably damaging	1.00
R3817:Nav2	UTSW	7	49464562	missense	probably benign	0.00
R3834:Nav2	UTSW	7	49545858	missense	possibly damaging	0.91
R4207:Nav2	UTSW	7	49572298	splice site	probably null
R4207:Nav2	UTSW	7	49597231	missense	probably damaging	1.00
R4411:Nav2	UTSW	7	49398109	missense	probably benign	0.37
R4413:Nav2	UTSW	7	49398109	missense	probably benign	0.37
R4440:Nav2	UTSW	7	49552037	missense	possibly damaging	0.86
R4440:Nav2	UTSW	7	49575263	splice site	probably benign
R4454:Nav2	UTSW	7	49548544	splice site	probably null
R4729:Nav2	UTSW	7	49452819	missense	probably benign	0.17
R4801:Nav2	UTSW	7	49545852	missense	possibly damaging	0.94
R4802:Nav2	UTSW	7	49545852	missense	possibly damaging	0.94
R4824:Nav2	UTSW	7	49409001	intron	probably benign
R4887:Nav2	UTSW	7	49548434	nonsense	probably null
R4908:Nav2	UTSW	7	49604510	missense	probably damaging	1.00
R4952:Nav2	UTSW	7	49304540	intron	probably benign
R4965:Nav2	UTSW	7	49552877	nonsense	probably null
R5169:Nav2	UTSW	7	49548483	nonsense	probably null
R5224:Nav2	UTSW	7	49551725	missense	probably benign	0.00
R5249:Nav2	UTSW	7	49535913	missense	probably damaging	1.00
R5285:Nav2	UTSW	7	49548234	missense	probably damaging	1.00
R5314:Nav2	UTSW	7	49408692	small deletion	probably benign
R5320:Nav2	UTSW	7	49491373	missense	probably benign	0.00
R5377:Nav2	UTSW	7	49589160	missense	probably benign	0.02
R5471:Nav2	UTSW	7	49548169	missense	probably damaging	1.00
R5754:Nav2	UTSW	7	49557046	missense	probably damaging	1.00
R5832:Nav2	UTSW	7	49548069	splice site	probably null
R5884:Nav2	UTSW	7	49597169	nonsense	probably null
R5921:Nav2	UTSW	7	49304576	intron	probably benign
R6180:Nav2	UTSW	7	49458167	missense	probably benign	0.39
R6208:Nav2	UTSW	7	49564103	missense	probably damaging	0.99
R6373:Nav2	UTSW	7	49453175	missense	probably damaging	1.00
R6450:Nav2	UTSW	7	49594366	missense	probably damaging	1.00
R6522:Nav2	UTSW	7	49597533	missense	probably damaging	1.00
R6626:Nav2	UTSW	7	49594352	missense	probably damaging	1.00
R6695:Nav2	UTSW	7	49464904	missense	probably benign	0.04
R6705:Nav2	UTSW	7	49551916	missense	probably damaging	1.00
R6842:Nav2	UTSW	7	49458169	missense	possibly damaging	0.91
R6847:Nav2	UTSW	7	49491456	missense	probably benign	0.14
R7287:Nav2	UTSW	7	49420328	missense	probably benign	0.01
R7312:Nav2	UTSW	7	49461924	missense	possibly damaging	0.55
R7315:Nav2	UTSW	7	49548289	missense	possibly damaging	0.61
R7337:Nav2	UTSW	7	49551773	missense	possibly damaging	0.56
R7366:Nav2	UTSW	7	49554203	splice site	probably null
R7451:Nav2	UTSW	7	49552829	splice site	probably null
R7545:Nav2	UTSW	7	49582857	missense	probably damaging	1.00
R7706:Nav2	UTSW	7	49594319	missense	probably benign	0.35
R7730:Nav2	UTSW	7	49572397	missense	probably damaging	1.00
R7812:Nav2	UTSW	7	49597173	missense	probably benign	0.13
R8097:Nav2	UTSW	7	49587777	missense	probably damaging	1.00
R8110:Nav2	UTSW	7	49551950	nonsense	probably null
R8119:Nav2	UTSW	7	49453484	missense	probably damaging	0.99
R8298:Nav2	UTSW	7	49554261	critical splice donor site	probably null
R8306:Nav2	UTSW	7	49546017	missense	probably benign	0.33
R8331:Nav2	UTSW	7	49452623	missense	probably benign
R8402:Nav2	UTSW	7	49453437	missense	probably benign	0.43
R8421:Nav2	UTSW	7	49452521	missense	probably benign
R8478:Nav2	UTSW	7	49461985	missense	probably damaging	0.99
R8724:Nav2	UTSW	7	49491436	missense	possibly damaging	0.82
R8753:Nav2	UTSW	7	49452572	missense	probably benign
R8835:Nav2	UTSW	7	49598803	missense	possibly damaging	0.83
R8933:Nav2	UTSW	7	49461957	missense	probably damaging	1.00
R8957:Nav2	UTSW	7	49571216	missense	probably damaging	1.00
R9069:Nav2	UTSW	7	49558813	missense	probably damaging	0.99
R9095:Nav2	UTSW	7	49604545	missense	probably damaging	1.00
R9223:Nav2	UTSW	7	49552851	missense	probably damaging	1.00
R9261:Nav2	UTSW	7	49597156	missense	probably damaging	1.00
X0023:Nav2	UTSW	7	49547899	missense	possibly damaging	0.47
Z1177:Nav2	UTSW	7	49452761	missense	possibly damaging	0.47
Z1177:Nav2	UTSW	7	49594223	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTCCTCCAAGATCGCCAGCTTTATC -3'
(R):5'- TGAGTGCCCCAGGCTAGAACTATG -3'

Sequencing Primer
(F):5'- TTTATCCCCAAAGGGGGCAAG -3'
(R):5'- GCCCCAGGCTAGAACTATGTATTG -3'

Posted On

2013-05-29