Incidental Mutation 'R0006:Nav2'
ID43639
Institutional Source Beutler Lab
Gene Symbol Nav2
Ensembl Gene ENSMUSG00000052512
Gene Nameneuron navigator 2
SynonymsRainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #R0006 (G1)
Quality Score186
Status Validated
Chromosome7
Chromosomal Location48908716-49610090 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49453230 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 531 (E531G)
Ref Sequence ENSEMBL: ENSMUSP00000139309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184124] [ENSMUST00000184945]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000064383
SMART Domains Protein: ENSMUSP00000066835
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
Blast:CH 18 79 2e-35 BLAST
PDB:2YRN|A 18 80 3e-33 PDB
SCOP:d1dxxa1 29 81 4e-15 SMART
low complexity region 94 102 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
coiled coil region 378 408 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 505 517 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000064395
AA Change: E592G

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: E592G

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183659
AA Change: E531G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: E531G

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184155
Predicted Effect probably benign
Transcript: ENSMUST00000184945
AA Change: E592G

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: E592G

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Meta Mutation Damage Score 0.0646 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Nav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Nav2 APN 7 49571194 missense probably damaging 1.00
IGL01150:Nav2 APN 7 49452521 missense probably benign 0.17
IGL01649:Nav2 APN 7 49575729 missense probably damaging 1.00
IGL01662:Nav2 APN 7 49571209 missense probably damaging 1.00
IGL02297:Nav2 APN 7 49594229 missense probably damaging 0.98
IGL02313:Nav2 APN 7 49558773 missense probably damaging 0.99
IGL02441:Nav2 APN 7 49452512 missense probably damaging 1.00
IGL02472:Nav2 APN 7 49546041 missense probably damaging 1.00
IGL02477:Nav2 APN 7 49582875 missense probably damaging 0.99
IGL02725:Nav2 APN 7 49565095 missense probably damaging 1.00
IGL02944:Nav2 APN 7 49420256 missense probably damaging 0.99
IGL02953:Nav2 APN 7 49548423 missense probably damaging 1.00
IGL03105:Nav2 APN 7 49464879 missense probably damaging 1.00
IGL03234:Nav2 APN 7 49462008 missense possibly damaging 0.94
IGL03274:Nav2 APN 7 49362099 missense probably damaging 1.00
IGL03294:Nav2 APN 7 49491457 nonsense probably null
R0070:Nav2 UTSW 7 49570714 missense probably damaging 1.00
R0113:Nav2 UTSW 7 49535953 missense probably damaging 1.00
R0306:Nav2 UTSW 7 49545903 missense probably benign 0.01
R0346:Nav2 UTSW 7 49604585 missense probably benign 0.11
R0539:Nav2 UTSW 7 49461938 missense probably damaging 1.00
R0669:Nav2 UTSW 7 49408683 missense probably damaging 1.00
R0785:Nav2 UTSW 7 49420333 missense probably benign 0.06
R0970:Nav2 UTSW 7 49584153 missense probably damaging 1.00
R1162:Nav2 UTSW 7 49536040 splice site probably benign
R1274:Nav2 UTSW 7 49604430 nonsense probably null
R1463:Nav2 UTSW 7 49535962 missense probably damaging 1.00
R1464:Nav2 UTSW 7 49362204 missense probably damaging 1.00
R1464:Nav2 UTSW 7 49362204 missense probably damaging 1.00
R1536:Nav2 UTSW 7 49545934 missense probably damaging 1.00
R1612:Nav2 UTSW 7 49571211 missense probably damaging 1.00
R1638:Nav2 UTSW 7 49452465 missense probably benign
R1731:Nav2 UTSW 7 49548174 missense probably damaging 1.00
R1734:Nav2 UTSW 7 49575720 missense probably damaging 1.00
R1865:Nav2 UTSW 7 49548195 missense possibly damaging 0.95
R1945:Nav2 UTSW 7 49464872 missense probably damaging 1.00
R1997:Nav2 UTSW 7 49548471 missense probably benign 0.16
R2061:Nav2 UTSW 7 49598897 splice site probably benign
R2117:Nav2 UTSW 7 49464580 missense probably benign 0.00
R2174:Nav2 UTSW 7 49452663 missense probably damaging 0.99
R2182:Nav2 UTSW 7 49597254 missense probably benign 0.38
R2251:Nav2 UTSW 7 49453277 missense probably damaging 1.00
R2283:Nav2 UTSW 7 49491404 missense probably damaging 1.00
R2343:Nav2 UTSW 7 49598817 missense possibly damaging 0.82
R2472:Nav2 UTSW 7 49408884 missense probably benign
R2568:Nav2 UTSW 7 49597564 missense probably damaging 1.00
R2656:Nav2 UTSW 7 49545942 missense probably damaging 1.00
R2964:Nav2 UTSW 7 49557032 missense probably damaging 1.00
R2966:Nav2 UTSW 7 49557032 missense probably damaging 1.00
R3817:Nav2 UTSW 7 49464562 missense probably benign 0.00
R3834:Nav2 UTSW 7 49545858 missense possibly damaging 0.91
R4207:Nav2 UTSW 7 49572298 splice site probably null
R4207:Nav2 UTSW 7 49597231 missense probably damaging 1.00
R4411:Nav2 UTSW 7 49398109 missense probably benign 0.37
R4413:Nav2 UTSW 7 49398109 missense probably benign 0.37
R4440:Nav2 UTSW 7 49552037 missense possibly damaging 0.86
R4440:Nav2 UTSW 7 49575263 splice site probably benign
R4454:Nav2 UTSW 7 49548544 splice site probably null
R4729:Nav2 UTSW 7 49452819 missense probably benign 0.17
R4801:Nav2 UTSW 7 49545852 missense possibly damaging 0.94
R4802:Nav2 UTSW 7 49545852 missense possibly damaging 0.94
R4824:Nav2 UTSW 7 49409001 intron probably benign
R4887:Nav2 UTSW 7 49548434 nonsense probably null
R4908:Nav2 UTSW 7 49604510 missense probably damaging 1.00
R4952:Nav2 UTSW 7 49304540 intron probably benign
R4965:Nav2 UTSW 7 49552877 nonsense probably null
R5169:Nav2 UTSW 7 49548483 nonsense probably null
R5224:Nav2 UTSW 7 49551725 missense probably benign 0.00
R5249:Nav2 UTSW 7 49535913 missense probably damaging 1.00
R5285:Nav2 UTSW 7 49548234 missense probably damaging 1.00
R5314:Nav2 UTSW 7 49408692 small deletion probably benign
R5320:Nav2 UTSW 7 49491373 missense probably benign 0.00
R5377:Nav2 UTSW 7 49589160 missense probably benign 0.02
R5471:Nav2 UTSW 7 49548169 missense probably damaging 1.00
R5754:Nav2 UTSW 7 49557046 missense probably damaging 1.00
R5832:Nav2 UTSW 7 49548069 unclassified probably null
R5884:Nav2 UTSW 7 49597169 nonsense probably null
R5921:Nav2 UTSW 7 49304576 intron probably benign
R6180:Nav2 UTSW 7 49458167 missense probably benign 0.39
R6208:Nav2 UTSW 7 49564103 missense probably damaging 0.99
R6373:Nav2 UTSW 7 49453175 missense probably damaging 1.00
R6450:Nav2 UTSW 7 49594366 missense probably damaging 1.00
R6522:Nav2 UTSW 7 49597533 missense probably damaging 1.00
R6626:Nav2 UTSW 7 49594352 missense probably damaging 1.00
R6695:Nav2 UTSW 7 49464904 missense probably benign 0.04
R6705:Nav2 UTSW 7 49551916 missense probably damaging 1.00
R6842:Nav2 UTSW 7 49458169 missense possibly damaging 0.91
R6847:Nav2 UTSW 7 49491456 missense probably benign 0.14
R7287:Nav2 UTSW 7 49420328 missense probably benign 0.01
R7312:Nav2 UTSW 7 49461924 missense possibly damaging 0.55
R7315:Nav2 UTSW 7 49548289 missense possibly damaging 0.61
R7337:Nav2 UTSW 7 49551773 missense possibly damaging 0.56
R7366:Nav2 UTSW 7 49554203 splice site probably null
R7451:Nav2 UTSW 7 49552829 splice site probably null
R7545:Nav2 UTSW 7 49582857 missense probably damaging 1.00
R7706:Nav2 UTSW 7 49594319 missense probably benign 0.35
R7730:Nav2 UTSW 7 49572397 missense probably damaging 1.00
R7812:Nav2 UTSW 7 49597173 missense probably benign 0.13
X0023:Nav2 UTSW 7 49547899 missense possibly damaging 0.47
Z1177:Nav2 UTSW 7 49452761 missense possibly damaging 0.47
Z1177:Nav2 UTSW 7 49594223 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCCTCCAAGATCGCCAGCTTTATC -3'
(R):5'- TGAGTGCCCCAGGCTAGAACTATG -3'

Sequencing Primer
(F):5'- TTTATCCCCAAAGGGGGCAAG -3'
(R):5'- GCCCCAGGCTAGAACTATGTATTG -3'
Posted On2013-05-29